Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0010 Transporter Info | ||||
| Gene Name | SLC22A1 | ||||
| Transporter Name | Organic cation transporter 1 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Bile duct carcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Hypermethylation of SLC22A1 in Bile duct carcinoma (compare with non-tumor adjacent tissue) | [ 1 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Related Molecular Changes | Down regulation ofSLC22A1 | Experiment Method | Immunofluorescence and Immunoblotting Assays | ||
|
Studied Phenotype |
Bile duct carcinoma[ ICD-11:2C12.1] | ||||
|
Experimental Material |
Lentiviral-mediated transduction of eCCA (EGI-1 and TFK-1) and iCCA (HuCCT1) cells | ||||
|
Additional Notes |
DNA Hypermethylation of individual CpG sites within the SLC22A1 gene is associated with downregulation of SLC22A1 expression in bile duct carcinoma. | ||||
|
Hepatocellular carcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Hypermethylation of SLC22A1 in hepatocellular carcinoma (compare with non-tumor adjacent tissue) | [ 2 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Methylation | Experiment Method | MALDI-TOF MS | ||
|
Related Molecular Changes | Down regulation ofSLC22A1 | Experiment Method | Western Blot | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Additional Notes |
DNA Hypermethylation of individual CpG sites within the SLC22A1 gene is associated with downregulation of SLC22A1 expression in HCC. | ||||
|
Epigenetic Phenomenon2 |
Hypermethylation of SLC22A1 in hepatocellular carcinoma (compare with non-tumor adjacent tissue) | [ 3 ] | |||
|
Location |
Promoter (cg13434757, cg27292431) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | HumanMethylation450 BeadChip | ||
|
Related Molecular Changes | Down regulation ofSLC22A1 | Experiment Method | RT-qPCR | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Additional Notes |
OCT1 expression was inversely correlated with SLC22A1 promoter methylation in hepatocellular, whereas demethylation with decitabine enhanced hOCT1 expression in hepatoma cells. | ||||
|
Diabetes |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Hypermethylation of SLC22A1 in diabetes | [ 4 ] | |||
|
Location |
Promoter (4 CpG sites) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | HumanMethylation450 BeadChip | ||
|
Studied Phenotype |
Diabetes[ ICD-11:5A10-5A14] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Additional Notes |
Metformin treatment directly decreased DNA methylation of SLC22A1 in hepatocytes cultured in vitro. | ||||
|
microRNA |
|||||
|
Unclear Phenotype |
7 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-3941 directly targets SLC22A1 | [ 5 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3941 | miRNA Mature ID | miR-3941 | ||
|
miRNA Sequence |
UUACACACAACUGAGGAUCAUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon2 |
miR-4275 directly targets SLC22A1 | [ 5 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4275 | miRNA Mature ID | miR-4275 | ||
|
miRNA Sequence |
CCAAUUACCACUUCUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon3 |
miR-466 directly targets SLC22A1 | [ 5 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-466 | miRNA Mature ID | miR-466 | ||
|
miRNA Sequence |
AUACACAUACACGCAACACACAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon4 |
miR-4672 directly targets SLC22A1 | [ 5 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4672 | miRNA Mature ID | miR-4672 | ||
|
miRNA Sequence |
UUACACAGCUGGACAGAGGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon5 |
miR-4687 directly targets SLC22A1 | [ 5 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4687 | miRNA Mature ID | miR-4687-5p | ||
|
miRNA Sequence |
CAGCCCUCCUCCCGCACCCAAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon6 |
miR-6768 directly targets SLC22A1 | [ 5 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6768 | miRNA Mature ID | miR-6768-5p | ||
|
miRNA Sequence |
CACACAGGAAAAGCGGGGCCCUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon7 |
miR-6856 directly targets SLC22A1 | [ 5 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6856 | miRNA Mature ID | miR-6856-3p | ||
|
miRNA Sequence |
UACAGCCCUGUGAUCUUUCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.