Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0010 Transporter Info
Gene Name SLC22A1
Transporter Name Organic cation transporter 1
Gene ID
6580
UniProt ID
O15245
Epigenetic Regulations of This DT (EGR)

Methylation

  Bile duct carcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Hypermethylation of SLC22A1 in Bile duct carcinoma (compare with non-tumor adjacent tissue) [ 1 ]

Location

 Promoter

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Related Molecular Changes

 Down regulation ofSLC22A1 Experiment Method Immunofluorescence and Immunoblotting Assays

Studied Phenotype

 Bile duct carcinoma[ ICD-11:2C12.1]

Experimental Material

 Lentiviral-mediated transduction of eCCA (EGI-1 and TFK-1) and iCCA (HuCCT1) cells

Additional Notes

 DNA Hypermethylation of individual CpG sites within the SLC22A1 gene is associated with downregulation of SLC22A1 expression in bile duct carcinoma.

  Hepatocellular carcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Hypermethylation of SLC22A1 in hepatocellular carcinoma (compare with non-tumor adjacent tissue) [ 2 ]

Location

 Promoter

Epigenetic Type

 Methylation Experiment Method MALDI-TOF MS

Related Molecular Changes

 Down regulation ofSLC22A1 Experiment Method Western Blot

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

Additional Notes

 DNA Hypermethylation of individual CpG sites within the SLC22A1 gene is associated with downregulation of SLC22A1 expression in HCC.

  Epigenetic Phenomenon2

 Hypermethylation of SLC22A1 in hepatocellular carcinoma (compare with non-tumor adjacent tissue) [ 3 ]

Location

 Promoter (cg13434757, cg27292431)

Epigenetic Type

 Methylation Experiment Method HumanMethylation450 BeadChip

Related Molecular Changes

 Down regulation ofSLC22A1 Experiment Method RT-qPCR

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

Additional Notes

 OCT1 expression was inversely correlated with SLC22A1 promoter methylation in hepatocellular, whereas demethylation with decitabine enhanced hOCT1 expression in hepatoma cells.

  Diabetes

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Hypermethylation of SLC22A1 in diabetes [ 4 ]

Location

 Promoter (4 CpG sites)

Epigenetic Type

 Methylation Experiment Method HumanMethylation450 BeadChip

Studied Phenotype

 Diabetes[ ICD-11:5A10-5A14]

Experimental Material

 Patient tissue samples

Additional Notes

 Metformin treatment directly decreased DNA methylation of SLC22A1 in hepatocytes cultured in vitro.

microRNA

  Unclear Phenotype

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 miR-3941 directly targets SLC22A1 [ 5 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3941 miRNA Mature ID miR-3941

miRNA Sequence

 UUACACACAACUGAGGAUCAUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon2

 miR-4275 directly targets SLC22A1 [ 5 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4275 miRNA Mature ID miR-4275

miRNA Sequence

 CCAAUUACCACUUCUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon3

 miR-466 directly targets SLC22A1 [ 5 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-466 miRNA Mature ID miR-466

miRNA Sequence

 AUACACAUACACGCAACACACAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon4

 miR-4672 directly targets SLC22A1 [ 5 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4672 miRNA Mature ID miR-4672

miRNA Sequence

 UUACACAGCUGGACAGAGGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon5

 miR-4687 directly targets SLC22A1 [ 5 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4687 miRNA Mature ID miR-4687-5p

miRNA Sequence

 CAGCCCUCCUCCCGCACCCAAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon6

 miR-6768 directly targets SLC22A1 [ 5 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6768 miRNA Mature ID miR-6768-5p

miRNA Sequence

 CACACAGGAAAAGCGGGGCCCUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon7

 miR-6856 directly targets SLC22A1 [ 5 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6856 miRNA Mature ID miR-6856-3p

miRNA Sequence

 UACAGCCCUGUGAUCUUUCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Perceived parental guan and school adjustment among Chinese early adolescents: The moderating role of interdependent self-construal. J Adolesc. 2019 Feb;71:18-27.
2 DNA methylation is associated with downregulation of the organic cation transporter OCT1 (SLC22A1) in human hepatocellular carcinoma. Genome Med. 2011 Dec 23;3(12):82.
3 Epigenetic events involved in organic cation transporter 1-dependent impaired response of hepatocellular carcinoma to sorafenib. Br J Pharmacol. 2019 Mar;176(6):787-800.
4 Diabetes medication associates with DNA methylation of metformin transporter genes in the human liver. Clin Epigenetics. 2017 Sep 21;9:102.
5 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.