Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0009 Transporter Info
Gene Name	SLC22A3
Transporter Name	Organic cation transporter 3
Gene ID	6581
UniProt ID	O75751

Epigenetic Regulations of This DT (EGR)
Methylation
Prostate cancer	15 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Hypermethylation of SLC22A3 in prostate cancer			[ 1 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Methylation-specific PCR
Related Molecular Changes	Down regulation ofSLC22A3	Experiment Method	RT-qPCR
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Frequency	62% of the studied tumor samples
Experimental Material	Patient tissue samples
Additional Notes	Aberrant methylation contributes to the reduced expression of OCT3 in prostate cancer.
Epigenetic Phenomenon2	Methylation of SLC22A3 in prostate cancer			[ 13 ]
Location	TSS1500 (cg19936194)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.82E+00	Statistic Test	p-value:1.10E-04; Z-score:8.72E+00
Methylation in Case	1.29E-01 (Median)	Methylation in Control	7.08E-02 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC22A3 in prostate cancer			[ 13 ]
Location	TSS1500 (cg27520549)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.12E+00	Statistic Test	p-value:2.31E-02; Z-score:1.66E+00
Methylation in Case	9.17E-01 (Median)	Methylation in Control	8.20E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC22A3 in prostate cancer			[ 13 ]
Location	TSS200 (cg07589968)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.41E+00	Statistic Test	p-value:7.97E-03; Z-score:7.46E+00
Methylation in Case	6.61E-01 (Median)	Methylation in Control	4.68E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC22A3 in prostate cancer			[ 13 ]
Location	1stExon (cg06987672)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.00E+00	Statistic Test	p-value:2.23E-02; Z-score:8.99E+00
Methylation in Case	1.78E-01 (Median)	Methylation in Control	8.89E-02 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC22A3 in prostate cancer			[ 13 ]
Location	1stExon (cg09840840)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.45E+00	Statistic Test	p-value:4.68E-02; Z-score:-2.18E+00
Methylation in Case	5.05E-02 (Median)	Methylation in Control	7.30E-02 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC22A3 in prostate cancer			[ 13 ]
Location	Body (cg03816707)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.12E+00	Statistic Test	p-value:2.57E-03; Z-score:3.88E+00
Methylation in Case	5.43E-01 (Median)	Methylation in Control	2.57E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC22A3 in prostate cancer			[ 13 ]
Location	Body (cg03924551)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.24E+00	Statistic Test	p-value:3.15E-03; Z-score:2.84E+00
Methylation in Case	8.75E-01 (Median)	Methylation in Control	7.08E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC22A3 in prostate cancer			[ 13 ]
Location	Body (cg02114341)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:3.96E-03; Z-score:3.03E+00
Methylation in Case	9.10E-01 (Median)	Methylation in Control	8.04E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC22A3 in prostate cancer			[ 13 ]
Location	Body (cg12619347)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.27E+00	Statistic Test	p-value:9.34E-03; Z-score:-3.31E+00
Methylation in Case	6.03E-01 (Median)	Methylation in Control	7.68E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC22A3 in prostate cancer			[ 13 ]
Location	Body (cg01432055)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:9.92E-03; Z-score:2.59E+00
Methylation in Case	9.52E-01 (Median)	Methylation in Control	9.18E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC22A3 in prostate cancer			[ 13 ]
Location	Body (cg09790270)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.36E+00	Statistic Test	p-value:2.57E-02; Z-score:2.30E+00
Methylation in Case	7.07E-01 (Median)	Methylation in Control	5.19E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC22A3 in prostate cancer			[ 13 ]
Location	Body (cg10125193)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:3.83E-02; Z-score:1.93E+00
Methylation in Case	9.09E-01 (Median)	Methylation in Control	8.51E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon14	Methylation of SLC22A3 in prostate cancer			[ 13 ]
Location	Body (cg20083442)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.48E+00	Statistic Test	p-value:3.92E-02; Z-score:-3.02E+00
Methylation in Case	4.19E-01 (Median)	Methylation in Control	6.17E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon15	Methylation of SLC22A3 in prostate cancer			[ 13 ]
Location	Body (cg22077670)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.27E+00	Statistic Test	p-value:4.81E-02; Z-score:1.81E+00
Methylation in Case	8.28E-01 (Median)	Methylation in Control	6.55E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Diabetes	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Hypermethylation of SLC22A3 in diabetes			[ 2 ]
Location	Promoter (5 CpG sites)
Epigenetic Type	Methylation	Experiment Method	HumanMethylation450 BeadChip
Related Molecular Changes	Down regulation ofSLC22A3	Experiment Method	RT-qPCR
Studied Phenotype	Diabetes[ ICD-11:5A10-5A14]
Experimental Material	Patient tissue samples
Additional Notes	Higher methylation in a CpG site located in SLC22A3 was associated with lower expression in the human liver and also with insulin plus metformin therapy, higher glucose levels, and BMI.
Esophageal squamous cell carcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Hypermethylation of SLC22A3 in esophageal squamous cell carcinoma			[ 3 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Methylation-specific PCR
Related Molecular Changes	Down regulation ofSLC22A3	Experiment Method	RT-qPCR
Studied Phenotype	Esophageal squamous cell carcinoma[ ICD-11:2E60.1]
Experimental Material	Patient tissue samples
Additional Notes	SLC22A3 promoter Hypermethylation may directly suppresses its gene transcription, resulting in increased susceptibility to ESCC in high-risk individuals.
Pancretic ductal adenocarcinoma	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC22A3 in pancretic ductal adenocarcinoma			[ 4 ]
Location	5'UTR (cg27403989)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.14E+00	Statistic Test	p-value:1.51E-05; Z-score:-1.23E+00
Methylation in Case	7.10E-01 (Median)	Methylation in Control	8.11E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC22A3 in pancretic ductal adenocarcinoma			[ 4 ]
Location	5'UTR (cg07007420)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:2.87E-04; Z-score:-4.82E-01
Methylation in Case	8.93E-01 (Median)	Methylation in Control	9.03E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC22A3 in pancretic ductal adenocarcinoma			[ 4 ]
Location	TSS1500 (cg13875111)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.20E+00	Statistic Test	p-value:3.67E-02; Z-score:-6.99E-01
Methylation in Case	1.48E-01 (Median)	Methylation in Control	1.78E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC22A3 in pancretic ductal adenocarcinoma			[ 4 ]
Location	TSS200 (cg04431946)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.39E+00	Statistic Test	p-value:2.19E-31; Z-score:5.00E+00
Methylation in Case	5.04E-01 (Median)	Methylation in Control	2.11E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC22A3 in pancretic ductal adenocarcinoma			[ 4 ]
Location	TSS200 (cg17920479)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.39E+00	Statistic Test	p-value:3.81E-18; Z-score:2.96E+00
Methylation in Case	4.49E-01 (Median)	Methylation in Control	3.22E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC22A3 in pancretic ductal adenocarcinoma			[ 4 ]
Location	TSS200 (cg18313899)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.72E+00	Statistic Test	p-value:7.48E-17; Z-score:3.10E+00
Methylation in Case	2.60E-01 (Median)	Methylation in Control	1.51E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC22A3 in pancretic ductal adenocarcinoma			[ 4 ]
Location	Body (cg27315497)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.25E+00	Statistic Test	p-value:1.32E-11; Z-score:2.34E+00
Methylation in Case	5.50E-01 (Median)	Methylation in Control	4.41E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC22A3 in pancretic ductal adenocarcinoma			[ 4 ]
Location	Body (cg09359103)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.44E+00	Statistic Test	p-value:3.74E-10; Z-score:-1.71E+00
Methylation in Case	3.31E-01 (Median)	Methylation in Control	4.76E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC22A3 in pancretic ductal adenocarcinoma			[ 4 ]
Location	Body (cg04860674)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:5.68E-09; Z-score:-9.67E-01
Methylation in Case	8.47E-01 (Median)	Methylation in Control	8.74E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC22A3 in pancretic ductal adenocarcinoma			[ 4 ]
Location	Body (cg04036777)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.16E+00	Statistic Test	p-value:3.60E-03; Z-score:-6.49E-01
Methylation in Case	4.40E-01 (Median)	Methylation in Control	5.12E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Bladder cancer	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC22A3 in bladder cancer			[ 5 ]
Location	TSS1500 (cg25313204)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.32E+00	Statistic Test	p-value:1.83E-03; Z-score:-2.09E+00
Methylation in Case	4.05E-01 (Median)	Methylation in Control	5.35E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC22A3 in bladder cancer			[ 5 ]
Location	TSS1500 (cg22117918)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.27E+00	Statistic Test	p-value:3.83E-02; Z-score:1.40E+00
Methylation in Case	2.03E-01 (Median)	Methylation in Control	1.60E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC22A3 in bladder cancer			[ 5 ]
Location	Body (cg23898998)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.46E+00	Statistic Test	p-value:2.00E-07; Z-score:-1.15E+01
Methylation in Case	4.58E-01 (Median)	Methylation in Control	6.68E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC22A3 in bladder cancer			[ 5 ]
Location	Body (cg09226986)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.69E+00	Statistic Test	p-value:3.02E-05; Z-score:5.16E+00
Methylation in Case	7.96E-01 (Median)	Methylation in Control	4.72E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC22A3 in bladder cancer			[ 5 ]
Location	Body (cg04794858)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.16E+00	Statistic Test	p-value:2.64E-04; Z-score:-5.28E+00
Methylation in Case	7.45E-01 (Median)	Methylation in Control	8.67E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC22A3 in bladder cancer			[ 5 ]
Location	Body (cg13280882)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:1.33E-03; Z-score:-1.96E+00
Methylation in Case	8.01E-01 (Median)	Methylation in Control	8.60E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC22A3 in bladder cancer			[ 5 ]
Location	Body (cg01923312)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.22E+00	Statistic Test	p-value:1.79E-03; Z-score:-3.77E+00
Methylation in Case	6.32E-01 (Median)	Methylation in Control	7.70E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC22A3 in bladder cancer			[ 5 ]
Location	Body (cg15363979)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:5.22E-03; Z-score:-3.02E+00
Methylation in Case	8.95E-01 (Median)	Methylation in Control	9.16E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC22A3 in bladder cancer			[ 5 ]
Location	Body (cg24358785)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.19E+00	Statistic Test	p-value:7.04E-03; Z-score:3.45E+00
Methylation in Case	6.73E-01 (Median)	Methylation in Control	5.67E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC22A3 in bladder cancer			[ 5 ]
Location	Body (cg06295784)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:1.23E-02; Z-score:-1.89E+00
Methylation in Case	6.17E-01 (Median)	Methylation in Control	6.75E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC22A3 in bladder cancer			[ 5 ]
Location	Body (cg14255768)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:3.15E-02; Z-score:-6.38E-01
Methylation in Case	5.07E-01 (Median)	Methylation in Control	5.23E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC22A3 in bladder cancer			[ 5 ]
Location	Body (cg17768600)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.14E+00	Statistic Test	p-value:4.23E-02; Z-score:1.81E+00
Methylation in Case	7.28E-01 (Median)	Methylation in Control	6.41E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC22A3 in bladder cancer			[ 5 ]
Location	3'UTR (cg00321824)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.41E+00	Statistic Test	p-value:9.40E-08; Z-score:-1.35E+01
Methylation in Case	5.70E-01 (Median)	Methylation in Control	8.03E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Breast cancer	22 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	TSS1500 (cg22117918)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.26E+00	Statistic Test	p-value:6.87E-09; Z-score:1.49E+00
Methylation in Case	2.80E-01 (Median)	Methylation in Control	2.22E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	TSS1500 (cg07883823)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.32E+00	Statistic Test	p-value:8.44E-08; Z-score:1.48E+00
Methylation in Case	3.14E-01 (Median)	Methylation in Control	2.37E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	TSS1500 (cg21110739)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:2.79E-07; Z-score:-1.26E+00
Methylation in Case	7.68E-01 (Median)	Methylation in Control	8.07E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	TSS1500 (cg25313204)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.08E+00	Statistic Test	p-value:2.50E-03; Z-score:-7.53E-01
Methylation in Case	5.95E-01 (Median)	Methylation in Control	6.44E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	TSS200 (cg17364114)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.41E+00	Statistic Test	p-value:3.71E-08; Z-score:1.16E+00
Methylation in Case	1.44E-01 (Median)	Methylation in Control	5.98E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	1stExon (cg07237939)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.63E+00	Statistic Test	p-value:2.56E-10; Z-score:1.90E+00
Methylation in Case	1.07E-01 (Median)	Methylation in Control	4.05E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	Body (cg23898998)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.50E+00	Statistic Test	p-value:2.93E-24; Z-score:-5.02E+00
Methylation in Case	4.70E-01 (Median)	Methylation in Control	7.03E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	Body (cg15020894)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.55E+00	Statistic Test	p-value:4.72E-22; Z-score:-3.09E+00
Methylation in Case	3.70E-01 (Median)	Methylation in Control	5.74E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	Body (cg04794858)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.37E+00	Statistic Test	p-value:5.42E-20; Z-score:-6.89E+00
Methylation in Case	6.27E-01 (Median)	Methylation in Control	8.60E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	Body (cg15363979)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:1.53E-14; Z-score:-3.09E+00
Methylation in Case	8.14E-01 (Median)	Methylation in Control	9.00E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	Body (cg09226986)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.61E+00	Statistic Test	p-value:3.47E-14; Z-score:2.89E+00
Methylation in Case	5.65E-01 (Median)	Methylation in Control	3.51E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	Body (cg13280882)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.14E+00	Statistic Test	p-value:7.63E-11; Z-score:-2.96E+00
Methylation in Case	7.44E-01 (Median)	Methylation in Control	8.44E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	Body (cg02042585)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.17E+00	Statistic Test	p-value:1.04E-10; Z-score:-1.73E+00
Methylation in Case	6.36E-01 (Median)	Methylation in Control	7.46E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon14	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	Body (cg17768600)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.18E+00	Statistic Test	p-value:8.44E-09; Z-score:-1.60E+00
Methylation in Case	5.70E-01 (Median)	Methylation in Control	6.70E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon15	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	Body (cg14255768)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.43E+00	Statistic Test	p-value:2.97E-08; Z-score:-1.87E+00
Methylation in Case	3.72E-01 (Median)	Methylation in Control	5.31E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon16	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	Body (cg19149031)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.13E+00	Statistic Test	p-value:3.69E-07; Z-score:-1.32E+00
Methylation in Case	7.54E-01 (Median)	Methylation in Control	8.50E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon17	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	Body (cg18126027)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.08E+00	Statistic Test	p-value:2.74E-06; Z-score:-1.25E+00
Methylation in Case	8.08E-01 (Median)	Methylation in Control	8.72E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon18	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	Body (cg24358785)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.12E+00	Statistic Test	p-value:5.55E-06; Z-score:-1.28E+00
Methylation in Case	5.57E-01 (Median)	Methylation in Control	6.23E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon19	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	Body (cg08303612)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.20E+00	Statistic Test	p-value:1.40E-05; Z-score:5.41E-01
Methylation in Case	1.39E-01 (Median)	Methylation in Control	1.17E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon20	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	Body (cg11696576)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:4.87E-04; Z-score:-5.11E-01
Methylation in Case	6.61E-01 (Median)	Methylation in Control	7.23E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon21	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	Body (cg06295784)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:1.43E-02; Z-score:1.15E-01
Methylation in Case	6.69E-01 (Median)	Methylation in Control	6.64E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon22	Methylation of SLC22A3 in breast cancer			[ 6 ]
Location	3'UTR (cg00321824)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.36E+00	Statistic Test	p-value:8.19E-16; Z-score:-3.48E+00
Methylation in Case	5.82E-01 (Median)	Methylation in Control	7.93E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC22A3 in clear cell renal cell carcinoma			[ 7 ]
Location	TSS1500 (cg21110739)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:1.42E-04; Z-score:-1.09E+00
Methylation in Case	8.93E-01 (Median)	Methylation in Control	9.15E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC22A3 in clear cell renal cell carcinoma			[ 7 ]
Location	TSS1500 (cg22117918)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:2.44E-02; Z-score:5.00E-01
Methylation in Case	1.61E-01 (Median)	Methylation in Control	1.39E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC22A3 in clear cell renal cell carcinoma			[ 7 ]
Location	TSS200 (cg17364114)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.29E+00	Statistic Test	p-value:3.51E-02; Z-score:2.07E-01
Methylation in Case	2.36E-02 (Median)	Methylation in Control	1.83E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC22A3 in clear cell renal cell carcinoma			[ 7 ]
Location	1stExon (cg07237939)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:2.53E-02; Z-score:2.01E-01
Methylation in Case	2.13E-02 (Median)	Methylation in Control	1.83E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC22A3 in clear cell renal cell carcinoma			[ 7 ]
Location	Body (cg15363979)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:1.51E-06; Z-score:-1.34E+00
Methylation in Case	9.14E-01 (Median)	Methylation in Control	9.37E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC22A3 in clear cell renal cell carcinoma			[ 7 ]
Location	Body (cg13280882)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:1.25E-02; Z-score:-6.79E-01
Methylation in Case	8.78E-01 (Median)	Methylation in Control	9.07E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC22A3 in clear cell renal cell carcinoma			[ 7 ]
Location	Body (cg02042585)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:1.81E-02; Z-score:-6.75E-01
Methylation in Case	8.61E-01 (Median)	Methylation in Control	8.93E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Colorectal cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC22A3 in colorectal cancer			[ 8 ]
Location	TSS1500 (cg21110739)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:6.15E-04; Z-score:-9.57E-01
Methylation in Case	9.30E-01 (Median)	Methylation in Control	9.38E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC22A3 in colorectal cancer			[ 8 ]
Location	Body (cg15363979)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:6.80E-04; Z-score:-1.16E+00
Methylation in Case	9.27E-01 (Median)	Methylation in Control	9.37E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC22A3 in colorectal cancer			[ 8 ]
Location	Body (cg23898998)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:1.75E-02; Z-score:-4.43E-01
Methylation in Case	8.50E-01 (Median)	Methylation in Control	8.68E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC22A3 in colorectal cancer			[ 8 ]
Location	Body (cg14255768)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:3.20E-02; Z-score:-6.66E-01
Methylation in Case	8.01E-01 (Median)	Methylation in Control	8.20E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC22A3 in colorectal cancer			[ 8 ]
Location	Body (cg11696576)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:4.56E-02; Z-score:-3.56E-01
Methylation in Case	8.90E-01 (Median)	Methylation in Control	9.08E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC22A3 in colorectal cancer			[ 8 ]
Location	Body (cg06295784)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.13E+00	Statistic Test	p-value:4.93E-02; Z-score:-7.32E-01
Methylation in Case	6.67E-01 (Median)	Methylation in Control	7.53E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC22A3 in colorectal cancer			[ 8 ]
Location	3'UTR (cg00321824)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:4.46E-03; Z-score:-3.83E-01
Methylation in Case	7.98E-01 (Median)	Methylation in Control	8.14E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	18 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	TSS1500 (cg26489057)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.77E+00	Statistic Test	p-value:1.47E-13; Z-score:3.67E+00
Methylation in Case	5.21E-01 (Median)	Methylation in Control	2.94E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	TSS1500 (cg07883823)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.43E+00	Statistic Test	p-value:3.54E-04; Z-score:-1.05E+00
Methylation in Case	1.21E-01 (Median)	Methylation in Control	1.72E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	TSS1500 (cg22117918)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.33E+00	Statistic Test	p-value:2.10E-03; Z-score:-9.30E-01
Methylation in Case	1.18E-01 (Median)	Methylation in Control	1.57E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	TSS200 (cg17364114)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.08E+00	Statistic Test	p-value:4.44E-04; Z-score:-5.64E-01
Methylation in Case	2.35E-02 (Median)	Methylation in Control	4.91E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	1stExon (cg07237939)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.43E+00	Statistic Test	p-value:1.91E-04; Z-score:-5.09E-01
Methylation in Case	3.13E-02 (Median)	Methylation in Control	4.48E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg00706648)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.25E+00	Statistic Test	p-value:8.10E-25; Z-score:-7.57E+00
Methylation in Case	6.38E-01 (Median)	Methylation in Control	7.97E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg14387909)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.69E+00	Statistic Test	p-value:8.57E-17; Z-score:-7.87E+00
Methylation in Case	5.26E-01 (Median)	Methylation in Control	8.87E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg03912954)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.41E+00	Statistic Test	p-value:5.76E-16; Z-score:5.00E+00
Methylation in Case	2.70E-01 (Median)	Methylation in Control	1.12E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg09226986)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:1.32E-08; Z-score:9.32E-01
Methylation in Case	8.31E-01 (Median)	Methylation in Control	7.89E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg15020894)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.28E+00	Statistic Test	p-value:3.42E-08; Z-score:-1.85E+00
Methylation in Case	3.56E-01 (Median)	Methylation in Control	4.56E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg11696576)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.28E+00	Statistic Test	p-value:3.62E-08; Z-score:-1.35E+00
Methylation in Case	4.35E-01 (Median)	Methylation in Control	5.57E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg13280882)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.13E+00	Statistic Test	p-value:3.47E-07; Z-score:-1.29E+00
Methylation in Case	7.15E-01 (Median)	Methylation in Control	8.09E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg06295784)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.23E+00	Statistic Test	p-value:1.53E-05; Z-score:-1.07E+00
Methylation in Case	4.25E-01 (Median)	Methylation in Control	5.22E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon14	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg08303612)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.23E+00	Statistic Test	p-value:2.82E-05; Z-score:-7.84E-01
Methylation in Case	6.81E-02 (Median)	Methylation in Control	8.34E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon15	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg02042585)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:7.03E-05; Z-score:6.58E-01
Methylation in Case	8.12E-01 (Median)	Methylation in Control	7.78E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon16	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg07349212)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.17E+00	Statistic Test	p-value:6.88E-04; Z-score:-7.22E-01
Methylation in Case	5.95E-02 (Median)	Methylation in Control	6.94E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon17	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg17768600)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:1.02E-02; Z-score:4.12E-01
Methylation in Case	7.32E-01 (Median)	Methylation in Control	7.05E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon18	Methylation of SLC22A3 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg18126027)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:4.86E-02; Z-score:-1.42E-01
Methylation in Case	8.64E-01 (Median)	Methylation in Control	8.69E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
HIV infection	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC22A3 in HIV infection			[ 10 ]
Location	TSS1500 (cg07883823)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.59E+00	Statistic Test	p-value:2.26E-06; Z-score:2.66E+00
Methylation in Case	2.44E-01 (Median)	Methylation in Control	1.54E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC22A3 in HIV infection			[ 10 ]
Location	TSS1500 (cg22117918)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.29E+00	Statistic Test	p-value:1.39E-05; Z-score:1.68E+00
Methylation in Case	2.15E-01 (Median)	Methylation in Control	1.66E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC22A3 in HIV infection			[ 10 ]
Location	TSS200 (cg17364114)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:6.68E+00	Statistic Test	p-value:1.28E-03; Z-score:2.10E+00
Methylation in Case	1.05E-01 (Median)	Methylation in Control	1.57E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC22A3 in HIV infection			[ 10 ]
Location	1stExon (cg07237939)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.79E+00	Statistic Test	p-value:1.88E-04; Z-score:2.08E+00
Methylation in Case	5.40E-02 (Median)	Methylation in Control	1.93E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC22A3 in HIV infection			[ 10 ]
Location	Body (cg04794858)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:1.40E-04; Z-score:-1.04E+00
Methylation in Case	8.88E-01 (Median)	Methylation in Control	9.20E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC22A3 in HIV infection			[ 10 ]
Location	Body (cg15020894)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.13E+00	Statistic Test	p-value:2.20E-04; Z-score:-1.03E+00
Methylation in Case	4.67E-01 (Median)	Methylation in Control	5.26E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC22A3 in HIV infection			[ 10 ]
Location	Body (cg08303612)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.29E+00	Statistic Test	p-value:5.28E-04; Z-score:1.21E+00
Methylation in Case	1.06E-01 (Median)	Methylation in Control	8.20E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC22A3 in HIV infection			[ 10 ]
Location	Body (cg15363979)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:6.38E-04; Z-score:1.19E+00
Methylation in Case	9.41E-01 (Median)	Methylation in Control	9.21E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC22A3 in HIV infection			[ 10 ]
Location	Body (cg23898998)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:8.23E-04; Z-score:-8.32E-01
Methylation in Case	8.10E-01 (Median)	Methylation in Control	8.44E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC22A3 in HIV infection			[ 10 ]
Location	Body (cg07349212)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.09E+00	Statistic Test	p-value:1.27E-02; Z-score:4.39E-01
Methylation in Case	7.00E-02 (Median)	Methylation in Control	6.43E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC22A3 in HIV infection			[ 10 ]
Location	Body (cg06295784)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:1.88E-02; Z-score:4.69E-01
Methylation in Case	7.91E-01 (Median)	Methylation in Control	7.73E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC22A3 in lung adenocarcinoma			[ 11 ]
Location	TSS1500 (cg22117918)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.49E+00	Statistic Test	p-value:6.40E-03; Z-score:2.54E+00
Methylation in Case	3.18E-01 (Median)	Methylation in Control	2.14E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC22A3 in lung adenocarcinoma			[ 11 ]
Location	TSS1500 (cg07883823)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.39E+00	Statistic Test	p-value:7.87E-03; Z-score:1.91E+00
Methylation in Case	3.37E-01 (Median)	Methylation in Control	2.42E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC22A3 in lung adenocarcinoma			[ 11 ]
Location	TSS200 (cg17364114)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:3.83E+00	Statistic Test	p-value:4.07E-04; Z-score:7.16E+00
Methylation in Case	3.25E-01 (Median)	Methylation in Control	8.50E-02 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC22A3 in lung adenocarcinoma			[ 11 ]
Location	1stExon (cg07237939)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:3.07E+00	Statistic Test	p-value:1.25E-03; Z-score:6.50E+00
Methylation in Case	2.05E-01 (Median)	Methylation in Control	6.68E-02 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC22A3 in lung adenocarcinoma			[ 11 ]
Location	Body (cg08303612)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.37E+00	Statistic Test	p-value:1.66E-02; Z-score:2.49E+00
Methylation in Case	1.68E-01 (Median)	Methylation in Control	1.23E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC22A3 in papillary thyroid cancer			[ 12 ]
Location	TSS1500 (cg21110739)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:2.00E-05; Z-score:-1.25E+00
Methylation in Case	8.76E-01 (Median)	Methylation in Control	8.96E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC22A3 in papillary thyroid cancer			[ 12 ]
Location	TSS1500 (cg22117918)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.09E+00	Statistic Test	p-value:3.61E-04; Z-score:5.18E-01
Methylation in Case	1.90E-01 (Median)	Methylation in Control	1.74E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC22A3 in papillary thyroid cancer			[ 12 ]
Location	TSS1500 (cg07883823)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.10E+00	Statistic Test	p-value:2.36E-03; Z-score:5.50E-01
Methylation in Case	2.21E-01 (Median)	Methylation in Control	2.00E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC22A3 in papillary thyroid cancer			[ 12 ]
Location	Body (cg04794858)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:2.01E-04; Z-score:-7.11E-01
Methylation in Case	8.89E-01 (Median)	Methylation in Control	9.04E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC22A3 in papillary thyroid cancer			[ 12 ]
Location	Body (cg13280882)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:6.45E-04; Z-score:-8.51E-01
Methylation in Case	9.40E-01 (Median)	Methylation in Control	9.51E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC22A3 in papillary thyroid cancer			[ 12 ]
Location	Body (cg15363979)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:2.75E-03; Z-score:-4.56E-01
Methylation in Case	8.89E-01 (Median)	Methylation in Control	8.95E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC22A3 in papillary thyroid cancer			[ 12 ]
Location	Body (cg06295784)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.39E-02; Z-score:-3.89E-01
Methylation in Case	8.43E-01 (Median)	Methylation in Control	8.54E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC22A3 in papillary thyroid cancer			[ 12 ]
Location	Body (cg18126027)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:2.68E-02; Z-score:-8.29E-01
Methylation in Case	8.96E-01 (Median)	Methylation in Control	9.15E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Colon cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC22A3 in colon adenocarcinoma			[ 14 ]
Location	TSS200 (cg13028471)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.20E+00	Statistic Test	p-value:3.50E-03; Z-score:-3.04E-01
Methylation in Case	6.58E-02 (Median)	Methylation in Control	7.87E-02 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC22A3 in colon adenocarcinoma			[ 14 ]
Location	Body (cg04186249)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.31E+00	Statistic Test	p-value:1.73E-06; Z-score:-4.75E+00
Methylation in Case	5.55E-01 (Median)	Methylation in Control	7.26E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC22A3 in colon adenocarcinoma			[ 14 ]
Location	Body (cg05275995)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:1.97E-03; Z-score:-1.88E+00
Methylation in Case	7.43E-01 (Median)	Methylation in Control	7.98E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC22A3 in colon adenocarcinoma			[ 14 ]
Location	Body (cg16523422)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.14E+00	Statistic Test	p-value:2.60E-03; Z-score:-2.01E+00
Methylation in Case	6.40E-01 (Median)	Methylation in Control	7.29E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC22A3 in colon adenocarcinoma			[ 14 ]
Location	Body (cg13071812)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.12E+00	Statistic Test	p-value:3.57E-03; Z-score:-6.98E-01
Methylation in Case	1.49E-01 (Median)	Methylation in Control	1.67E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC22A3 in colon adenocarcinoma			[ 14 ]
Location	3'UTR (cg20678043)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.29E+00	Statistic Test	p-value:4.17E-05; Z-score:-3.56E+00
Methylation in Case	5.67E-01 (Median)	Methylation in Control	7.30E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC22A3 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	1stExon (cg07237939)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.42E+00	Statistic Test	p-value:2.39E-21; Z-score:-3.90E+00
Methylation in Case	5.59E-01 (Median)	Methylation in Control	7.93E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC22A3 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	Body (cg01923312)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.19E+00	Statistic Test	p-value:1.03E-04; Z-score:-8.99E-01
Methylation in Case	6.58E-01 (Median)	Methylation in Control	7.86E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC22A3 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	Body (cg02042585)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:1.11E-04; Z-score:-9.25E-01
Methylation in Case	7.57E-01 (Median)	Methylation in Control	8.11E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC22A3 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	Body (cg04794858)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:9.54E-04; Z-score:7.88E-01
Methylation in Case	8.89E-01 (Median)	Methylation in Control	8.20E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC22A3 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	Body (cg06295784)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:2.27E-03; Z-score:6.78E-01
Methylation in Case	9.31E-01 (Median)	Methylation in Control	9.09E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC22A3 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	Body (cg07349212)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:3.84E-03; Z-score:-6.99E-01
Methylation in Case	7.37E-01 (Median)	Methylation in Control	7.90E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC22A3 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	Body (cg08303612)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.17E+00	Statistic Test	p-value:5.74E-03; Z-score:4.06E-01
Methylation in Case	1.43E-01 (Median)	Methylation in Control	1.22E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC22A3 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	Body (cg09226986)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:9.57E-03; Z-score:-4.48E-01
Methylation in Case	9.19E-01 (Median)	Methylation in Control	9.27E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC22A3 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	Body (cg11696576)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:2.46E-02; Z-score:-4.55E-01
Methylation in Case	7.03E-01 (Median)	Methylation in Control	7.40E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC22A3 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	Body (cg13280882)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:3.38E-02; Z-score:-1.20E-01
Methylation in Case	9.68E-01 (Median)	Methylation in Control	9.72E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC22A3 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	Body (cg14255768)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:4.39E-02; Z-score:5.86E-01
Methylation in Case	8.00E-01 (Median)	Methylation in Control	7.47E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC22A3 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	3'UTR (cg00321824)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.28E+00	Statistic Test	p-value:9.49E-16; Z-score:-2.45E+00
Methylation in Case	5.95E-01 (Median)	Methylation in Control	7.62E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Panic disorder	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC22A3 in panic disorder			[ 16 ]
Location	Body (cg18126027)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.18E+00	Statistic Test	p-value:6.78E-03; Z-score:7.21E-01
Methylation in Case	1.71E+00 (Median)	Methylation in Control	1.45E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC22A3 in panic disorder			[ 16 ]
Location	Body (cg01923312)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-5.04E-01	Statistic Test	p-value:2.49E-02; Z-score:-3.16E-01
Methylation in Case	-2.68E-01 (Median)	Methylation in Control	-1.35E-01 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC22A3 in systemic lupus erythematosus			[ 17 ]
Location	Body (cg14255768)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:6.48E-04; Z-score:-1.39E-01
Methylation in Case	5.99E-01 (Median)	Methylation in Control	6.07E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC22A3 in systemic lupus erythematosus			[ 17 ]
Location	Body (cg15363979)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:2.56E-02; Z-score:-1.17E-01
Methylation in Case	9.10E-01 (Median)	Methylation in Control	9.12E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC22A3 in systemic lupus erythematosus			[ 17 ]
Location	Body (cg04794858)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:2.59E-02; Z-score:-2.29E-01
Methylation in Case	8.66E-01 (Median)	Methylation in Control	8.75E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC22A3 in systemic lupus erythematosus			[ 17 ]
Location	Body (cg23898998)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:3.27E-02; Z-score:-1.47E-01
Methylation in Case	7.86E-01 (Median)	Methylation in Control	7.95E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC22A3 in systemic lupus erythematosus			[ 17 ]
Location	Body (cg19149031)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.00E+00	Statistic Test	p-value:4.01E-02; Z-score:6.60E-02
Methylation in Case	8.69E-01 (Median)	Methylation in Control	8.65E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
microRNA
Coronary artery disease	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	miR-147a downregulates SLC22A3 expression in coronary artery disease			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
Related Molecular Changes	Down regulation ofSLC22A3	Experiment Method	RT-qPCR
miRNA Stemloop ID	miR-147a	miRNA Mature ID	Unclear
miRNA Target Type	Direct
Studied Phenotype	Coronary artery disease[ ICD-11:BA6Z]
Experimental Material	Multiple cell lines of human
Additional Notes	The rs3088442 G allele might suppress miR-147a binding to the 3'-UTR region of SLC22A3, resulting in altered SLC22A3 and LPA gene expression.
Unclear Phenotype	24 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	miR-124 directly targets SLC22A3			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-124	miRNA Mature ID	miR-124-3p
miRNA Sequence	UAAGGCACGCGGUGAAUGCCAA
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)
Epigenetic Phenomenon2	miR-1272 directly targets SLC22A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1272	miRNA Mature ID	miR-1272
miRNA Sequence	GAUGAUGAUGGCAGCAAAUUCUGAAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon3	miR-130b directly targets SLC22A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-130b	miRNA Mature ID	miR-130b-5p
miRNA Sequence	ACUCUUUCCCUGUUGCACUAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon4	miR-1322 directly targets SLC22A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1322	miRNA Mature ID	miR-1322
miRNA Sequence	GAUGAUGCUGCUGAUGCUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon5	miR-147a directly targets SLC22A3			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
miRNA Stemloop ID	miR-147a	miRNA Mature ID	miR-147a
miRNA Sequence	GUGUGUGGAAAUGCUUCUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon6	miR-148b directly targets SLC22A3			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-148b	miRNA Mature ID	miR-148b-3p
miRNA Sequence	UCAGUGCAUCACAGAACUUUGU
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)
Epigenetic Phenomenon7	miR-23a directly targets SLC22A3			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-23a	miRNA Mature ID	miR-23a-5p
miRNA Sequence	GGGGUUCCUGGGGAUGGGAUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon8	miR-23b directly targets SLC22A3			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-23b	miRNA Mature ID	miR-23b-5p
miRNA Sequence	UGGGUUCCUGGCAUGCUGAUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon9	miR-3940 directly targets SLC22A3			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3940	miRNA Mature ID	miR-3940-5p
miRNA Sequence	GUGGGUUGGGGCGGGCUCUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon10	miR-4291 directly targets SLC22A3			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4291	miRNA Mature ID	miR-4291
miRNA Sequence	UUCAGCAGGAACAGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon11	miR-4330 directly targets SLC22A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4330	miRNA Mature ID	miR-4330
miRNA Sequence	CCUCAGAUCAGAGCCUUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon12	miR-4494 directly targets SLC22A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4494	miRNA Mature ID	miR-4494
miRNA Sequence	CCAGACUGUGGCUGACCAGAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon13	miR-4507 directly targets SLC22A3			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4507	miRNA Mature ID	miR-4507
miRNA Sequence	CUGGGUUGGGCUGGGCUGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon14	miR-452 directly targets SLC22A3			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-452	miRNA Mature ID	miR-452-3p
miRNA Sequence	CUCAUCUGCAAAGAAGUAAGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon15	miR-4639 directly targets SLC22A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4639	miRNA Mature ID	miR-4639-3p
miRNA Sequence	UCACUCUCACCUUGCUUUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon16	miR-4753 directly targets SLC22A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4753	miRNA Mature ID	miR-4753-3p
miRNA Sequence	UUCUCUUUCUUUAGCCUUGUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon17	miR-499b directly targets SLC22A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-499b	miRNA Mature ID	miR-499b-5p
miRNA Sequence	ACAGACUUGCUGUGAUGUUCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon18	miR-515 directly targets SLC22A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-515	miRNA Mature ID	miR-515-5p
miRNA Sequence	UUCUCCAAAAGAAAGCACUUUCUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon19	miR-519d directly targets SLC22A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-519d	miRNA Mature ID	miR-519d-5p
miRNA Sequence	CCUCCAAAGGGAAGCGCUUUCUGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon20	miR-519e directly targets SLC22A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-519e	miRNA Mature ID	miR-519e-5p
miRNA Sequence	UUCUCCAAAAGGGAGCACUUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon21	miR-545 directly targets SLC22A3			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-545	miRNA Mature ID	miR-545-3p
miRNA Sequence	UCAGCAAACAUUUAUUGUGUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon22	miR-5695 directly targets SLC22A3			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5695	miRNA Mature ID	miR-5695
miRNA Sequence	ACUCCAAGAAGAAUCUAGACAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon23	miR-6839 directly targets SLC22A3			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6839	miRNA Mature ID	miR-6839-3p
miRNA Sequence	UUGGGUUUUCUCUUCAAUCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon24	miR-9 directly targets SLC22A3			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-9	miRNA Mature ID	miR-9-5p
miRNA Sequence	UCUUUGGUUAUCUAGCUGUAUGA
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)

References
1	Genetic and epigenetic regulation of the organic cation transporter 3, SLC22A3. Pharmacogenomics J. 2013 Apr;13(2):110-20.
2	Diabetes medication associates with DNA methylation of metformin transporter genes in the human liver. Clin Epigenetics. 2017 Sep 21;9:102.
3	Epigenetic alterations of a novel antioxidant gene SLC22A3 predispose susceptible individuals to increased risk of esophageal cancer. Int J Biol Sci. 2018 Sep 7;14(12):1658-1668.
4	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
5	DNA Methylation Dynamics in Urological Tumors.
6	Genome-wide Scan for Methylation Profiles in Breast Cancer
7	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
8	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
9	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
10	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
11	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
12	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
13	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
14	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
15	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
16	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
17	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
18	Functional Variant in the SLC22A3-LPAL2-LPA Gene Cluster Contributes to the Severity of Coronary Artery Disease. Arterioscler Thromb Vasc Biol. 2016 Sep;36(9):1989-96.
19	The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.
20	Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.
21	MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007 Jul 6;27(1):91-105.
22	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence