Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0008 Transporter Info
Gene Name SLCO1B1
Transporter Name Organic anion transporting polypeptide 1B1
Gene ID
10599
UniProt ID
Q9Y6L6
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLCO1B1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg14997702)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.35E+00 Statistic Test p-value:1.03E-06; Z-score:-1.24E+00

Methylation in Case

 3.15E-01 (Median) Methylation in Control 4.24E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLCO1B1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg04579507)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.05E+00 Statistic Test p-value:8.77E-04; Z-score:8.04E-01

Methylation in Case

 9.07E-01 (Median) Methylation in Control 8.64E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLCO1B1 in bladder cancer [ 2 ]

Location

 5'UTR (cg14997702)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.20E+00 Statistic Test p-value:2.39E-06; Z-score:-4.65E+00

Methylation in Case

 4.52E-01 (Median) Methylation in Control 5.43E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLCO1B1 in bladder cancer [ 2 ]

Location

 TSS1500 (cg00995065)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-2.32E+00 Statistic Test p-value:3.61E-09; Z-score:-1.83E+01

Methylation in Case

 3.25E-01 (Median) Methylation in Control 7.53E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLCO1B1 in bladder cancer [ 2 ]

Location

 Body (cg04579507)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-3.54E+00 Statistic Test p-value:2.64E-05; Z-score:-5.39E+00

Methylation in Case

 8.15E-02 (Median) Methylation in Control 2.89E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLCO1B1 in breast cancer [ 3 ]

Location

 5'UTR (cg14997702)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.08E+00 Statistic Test p-value:3.41E-06; Z-score:-1.08E+00

Methylation in Case

 4.86E-01 (Median) Methylation in Control 5.23E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLCO1B1 in breast cancer [ 3 ]

Location

 TSS1500 (cg00995065)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.12E+00 Statistic Test p-value:3.88E-02; Z-score:-7.70E-01

Methylation in Case

 5.45E-01 (Median) Methylation in Control 6.10E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLCO1B1 in colorectal cancer [ 4 ]

Location

 5'UTR (cg14997702)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.06E+00 Statistic Test p-value:2.96E-08; Z-score:-1.53E+00

Methylation in Case

 7.02E-01 (Median) Methylation in Control 7.46E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLCO1B1 in colorectal cancer [ 4 ]

Location

 TSS1500 (cg00995065)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.17E+00 Statistic Test p-value:2.83E-09; Z-score:-3.42E+00

Methylation in Case

 7.05E-01 (Median) Methylation in Control 8.28E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLCO1B1 in lung adenocarcinoma [ 5 ]

Location

 5'UTR (cg14997702)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.06E+00 Statistic Test p-value:2.44E-02; Z-score:-1.08E+00

Methylation in Case

 5.51E-01 (Median) Methylation in Control 5.86E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLCO1B1 in systemic lupus erythematosus [ 6 ]

Location

 5'UTR (cg14997702)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:1.57E-02; Z-score:-5.95E-02

Methylation in Case

 6.53E-01 (Median) Methylation in Control 6.57E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLCO1B1 in hepatocellular carcinoma [ 7 ]

Location

 TSS1500 (cg00995065)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.32E+00 Statistic Test p-value:1.50E-07; Z-score:-1.50E+00

Methylation in Case

 4.15E-01 (Median) Methylation in Control 5.46E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLCO1B1 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg09954729)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.38E+00 Statistic Test p-value:2.33E-12; Z-score:-6.61E+00

Methylation in Case

 6.88E-01 (Median) Methylation in Control 9.47E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLCO1B1 in HIV infection [ 8 ]

Location

 TSS1500 (cg00995065)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.09E+00 Statistic Test p-value:3.42E-05; Z-score:-1.20E+00

Methylation in Case

 7.50E-01 (Median) Methylation in Control 8.15E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLCO1B1 in HIV infection [ 8 ]

Location

 Body (cg04579507)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.15E+00 Statistic Test p-value:5.69E-04; Z-score:-1.01E+00

Methylation in Case

 3.84E-01 (Median) Methylation in Control 4.43E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLCO1B1 in papillary thyroid cancer [ 9 ]

Location

 TSS1500 (cg00995065)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.00E+00 Statistic Test p-value:2.25E-02; Z-score:-1.16E-02

Methylation in Case

 7.97E-01 (Median) Methylation in Control 7.97E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLCO1B1 in papillary thyroid cancer [ 9 ]

Location

 Body (cg04579507)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.18E+00 Statistic Test p-value:5.75E-04; Z-score:-8.24E-01

Methylation in Case

 2.31E-01 (Median) Methylation in Control 2.72E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLCO1B1 in pancretic ductal adenocarcinoma [ 10 ]

Location

 TSS200 (cg07191594)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.30E+00 Statistic Test p-value:4.65E-11; Z-score:2.02E+00

Methylation in Case

 4.16E-01 (Median) Methylation in Control 3.21E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLCO1B1 in pancretic ductal adenocarcinoma [ 10 ]

Location

 Body (cg09325101)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.13E+00 Statistic Test p-value:1.71E-02; Z-score:-8.21E-01

Methylation in Case

 5.28E-01 (Median) Methylation in Control 5.96E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

microRNA

  Hepatocellular carcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 miR-206 downregulates SLCO1B1 expression [ 11 ]

Epigenetic Type

 microRNA Experiment Method Luciferase reporter assay

Related Molecular Changes

 Down regulation ofSLCO1B1 Experiment Method Western Blot

miRNA Stemloop ID

 miR-206 miRNA Mature ID miR-206

miRNA Sequence

 UGGAAUGUAAGGAAGUGUGUGG

miRNA Target Type

 Direct

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Human hepatocellular carcinoma cell line (HepG2)

Additional Notes

 miR-206 post-transcriptionally regulates the expression of OATP1B1 protein by directly targeting the 3-UTR of OATP1B1 mRNA.

  Epigenetic Phenomenon2

 miR-613 downregulates SLCO1B1 expression [ 11 ]

Epigenetic Type

 microRNA Experiment Method Luciferase reporter assay

Related Molecular Changes

 Down regulation ofSLCO1B1 Experiment Method Western Blot

miRNA Stemloop ID

 miR-613 miRNA Mature ID miR-613

miRNA Sequence

 AGGAAUGUUCCUUCUUUGCC

miRNA Target Type

 Direct

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Human hepatocellular carcinoma cell line (HepG2)

Additional Notes

 miR-613 post-transcriptionally regulates the expression of OATP1B1 protein by directly targeting the 3-UTR of OATP1B1 mRNA.

  Steatosis

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 miR-511 downregulates SLCO1B1 expression in steatosis cell [ 12 ]

Epigenetic Type

 microRNA Experiment Method Dual-luciferase reporter assay

Related Molecular Changes

 Down regulation ofSLCO1B1 Experiment Method Western Blot

miRNA Stemloop ID

 miR-511 miRNA Mature ID miR-511-5p

miRNA Sequence

 GUGUCUUUUGCUCUGCAGUCA

miRNA Target Type

 Direct

Studied Phenotype

 Steatosis[ ICD-11:5D0Y]

Experimental Material

 Patient tissue samples

Additional Notes

 miR-511 interacted with SLCO1B1 3'-UTR for its role in post-transcriptional regulation.

  Unclear Phenotype

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 miR-26b directly targets SLCO1B1 [ 13 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-26b miRNA Mature ID miR-26b-5p

miRNA Sequence

 UUCAAGUAAUUCAGGAUAGGU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon2

 miR-335 directly targets SLCO1B1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

 UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon3

 miR-511 directly targets SLCO1B1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method Luciferase reporter assay//qRT-PCR//Western blot

miRNA Stemloop ID

 miR-511 miRNA Mature ID miR-511-5p

miRNA Sequence

 GUGUCUUUUGCUCUGCAGUCA

miRNA Target Type

 Direct

Experimental Material

 Patient tissue samples
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
6 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
7 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
11 Effect and mechanism of miR-206/miR-613 on expression of OATP1B1. Yao Xue Xue Bao. 2016 Dec;51(12):1858-63.
12 Role of miR-511 in the Regulation of OATP1B1 Expression by Free Fatty Acid. Biomol Ther (Seoul). 2015 Sep;23(5):400-6.
13 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.
14 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.