General Information of Drug Transporter (DT)
DT ID DTD0007 Transporter Info
Gene Name SLC47A1
Transporter Name Multidrug and toxin extrusion protein 1
Gene ID
55244
UniProt ID
Q96FL8
Epigenetic Regulations of This DT (EGR)

Methylation

  Diabetes

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Hypermethylation of SLC47A1 in diabetes [ 1 ]

Location

Promoter (11 CpG sites)

Epigenetic Type

Methylation Experiment Method HumanMethylation450 BeadChip

Related Molecular Changes

Down regulation ofSLC47A1 Experiment Method BeadChip

Studied Phenotype

Diabetes[ ICD-11:5A10-5A14]

Experimental Material

Patient tissue samples

Additional Notes

Lower average and promoter DNA methylation of SLC47A1 was found in diabetic subjects receiving just metformin,compared to those who took insulin plus metformin or no diabetes medication.

  Human liver tissue

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Hypermethylation of SLC47A1 in human liver tissue [ 2 ]

Location

27 kb upstream of gene

Epigenetic Type

Methylation Experiment Method Bisulfite sequencing

Related Molecular Changes

Down regulation ofSLC47A1 Experiment Method Semiquantitative RT-PCR

Studied Phenotype

Human liver tissue

Experimental Material

Caucasian patient tissue samples

Additional Notes

A relationship was not found between DNA methylation in the SLC47A1 promoter and MATE1 mRNA expression.

  Non-alcoholic fatty liver disease

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Hypermethylation of SLC47A1 in non-alcoholic fatty liver disease [ 3 ]

Location

6 CpG sites

Epigenetic Type

Methylation Experiment Method HumanMethylation450 BeadChip

Related Molecular Changes

Down regulation ofSLC47A1 Experiment Method Methylation microarray

Studied Phenotype

Non-alcoholic fatty liver disease[ ICD-11:DB92]

Experimental Material

Patient tissue samples

Additional Notes

SLC47A1 was detected to be significantly inversely associated with the transcriptional expression.

  Colon cancer

           7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC47A1 in colon adenocarcinoma [ 4 ]

Location

5'UTR (cg05373457)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.30E+00 Statistic Test p-value:1.89E-06; Z-score:2.08E+00

Methylation in Case

5.58E-01 (Median) Methylation in Control 4.29E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC47A1 in colon adenocarcinoma [ 4 ]

Location

TSS1500 (cg02577240)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.16E+00 Statistic Test p-value:7.18E-04; Z-score:-1.49E+00

Methylation in Case

6.01E-01 (Median) Methylation in Control 6.98E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC47A1 in colon adenocarcinoma [ 4 ]

Location

TSS200 (cg05311412)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.34E+00 Statistic Test p-value:7.92E-07; Z-score:3.02E+00

Methylation in Case

6.11E-01 (Median) Methylation in Control 2.60E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC47A1 in colon adenocarcinoma [ 4 ]

Location

Body (cg01454305)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.46E+00 Statistic Test p-value:3.53E-07; Z-score:-3.88E+00

Methylation in Case

4.91E-01 (Median) Methylation in Control 7.16E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC47A1 in colon adenocarcinoma [ 4 ]

Location

Body (cg10311318)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:4.42E-04; Z-score:8.90E-01

Methylation in Case

5.39E-01 (Median) Methylation in Control 4.72E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC47A1 in colon adenocarcinoma [ 4 ]

Location

Body (cg12866656)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:2.22E-03; Z-score:-1.58E+00

Methylation in Case

5.17E-01 (Median) Methylation in Control 6.16E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC47A1 in colon adenocarcinoma [ 4 ]

Location

3'UTR (cg08828816)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:4.55E-03; Z-score:-2.33E+00

Methylation in Case

6.88E-01 (Median) Methylation in Control 7.42E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

         18 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC47A1 in hepatocellular carcinoma [ 5 ]

Location

5'UTR (cg14932645)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:5.28E-10; Z-score:-3.98E+00

Methylation in Case

7.68E-01 (Median) Methylation in Control 8.67E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC47A1 in hepatocellular carcinoma [ 5 ]

Location

TSS1500 (cg21692194)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:8.19E-06; Z-score:-6.73E-01

Methylation in Case

1.09E-01 (Median) Methylation in Control 1.28E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC47A1 in hepatocellular carcinoma [ 5 ]

Location

TSS1500 (cg15971010)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.40E+00 Statistic Test p-value:6.81E-04; Z-score:-8.39E-01

Methylation in Case

1.08E-01 (Median) Methylation in Control 1.50E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC47A1 in hepatocellular carcinoma [ 5 ]

Location

TSS1500 (cg25387636)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.46E+00 Statistic Test p-value:1.62E-02; Z-score:-8.51E-01

Methylation in Case

5.88E-02 (Median) Methylation in Control 8.59E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC47A1 in hepatocellular carcinoma [ 5 ]

Location

TSS1500 (cg12133118)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:1.66E-02; Z-score:-7.27E-01

Methylation in Case

3.22E-01 (Median) Methylation in Control 3.67E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC47A1 in hepatocellular carcinoma [ 5 ]

Location

TSS200 (cg07829432)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.24E+00 Statistic Test p-value:6.45E-04; Z-score:-7.82E-01

Methylation in Case

8.02E-02 (Median) Methylation in Control 9.95E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC47A1 in hepatocellular carcinoma [ 5 ]

Location

TSS200 (cg15014549)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:6.52E-03; Z-score:-5.87E-01

Methylation in Case

6.69E-02 (Median) Methylation in Control 7.54E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC47A1 in hepatocellular carcinoma [ 5 ]

Location

TSS200 (cg13004927)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.28E+00 Statistic Test p-value:1.84E-02; Z-score:-2.52E-01

Methylation in Case

2.58E-02 (Median) Methylation in Control 3.31E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC47A1 in hepatocellular carcinoma [ 5 ]

Location

Body (cg02068832)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.79E+00 Statistic Test p-value:1.39E-18; Z-score:-6.05E+00

Methylation in Case

4.16E-01 (Median) Methylation in Control 7.44E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC47A1 in hepatocellular carcinoma [ 5 ]

Location

Body (cg16925177)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.67E+00 Statistic Test p-value:3.76E-17; Z-score:-5.57E+00

Methylation in Case

4.81E-01 (Median) Methylation in Control 8.03E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC47A1 in hepatocellular carcinoma [ 5 ]

Location

Body (cg05510976)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.51E+00 Statistic Test p-value:2.88E-16; Z-score:-6.93E+00

Methylation in Case

5.25E-01 (Median) Methylation in Control 7.91E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC47A1 in hepatocellular carcinoma [ 5 ]

Location

Body (cg07566700)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.36E+00 Statistic Test p-value:5.37E-16; Z-score:-4.42E+00

Methylation in Case

5.62E-01 (Median) Methylation in Control 7.66E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC47A1 in hepatocellular carcinoma [ 5 ]

Location

Body (cg00601711)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.19E+00 Statistic Test p-value:4.46E-12; Z-score:2.14E+00

Methylation in Case

7.63E-01 (Median) Methylation in Control 6.42E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC47A1 in hepatocellular carcinoma [ 5 ]

Location

Body (cg10718608)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.32E+00 Statistic Test p-value:4.40E-08; Z-score:-1.60E+00

Methylation in Case

3.71E-01 (Median) Methylation in Control 4.91E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC47A1 in hepatocellular carcinoma [ 5 ]

Location

Body (cg08895056)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.31E+00 Statistic Test p-value:8.41E-08; Z-score:-1.61E+00

Methylation in Case

3.71E-01 (Median) Methylation in Control 4.87E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC47A1 in hepatocellular carcinoma [ 5 ]

Location

Body (cg20930201)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.27E+00 Statistic Test p-value:1.63E-05; Z-score:-7.83E-01

Methylation in Case

1.15E-01 (Median) Methylation in Control 1.45E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC47A1 in hepatocellular carcinoma [ 5 ]

Location

Body (cg12894055)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.38E+00 Statistic Test p-value:5.37E-03; Z-score:-1.06E+00

Methylation in Case

9.94E-02 (Median) Methylation in Control 1.37E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon18

Methylation of SLC47A1 in hepatocellular carcinoma [ 5 ]

Location

3'UTR (cg12550399)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:7.52E-05; Z-score:3.90E-01

Methylation in Case

7.69E-01 (Median) Methylation in Control 7.40E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

         15 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC47A1 in pancretic ductal adenocarcinoma [ 6 ]

Location

5'UTR (cg26590537)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.70E+00 Statistic Test p-value:1.17E-24; Z-score:3.82E+00

Methylation in Case

4.11E-01 (Median) Methylation in Control 1.52E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC47A1 in pancretic ductal adenocarcinoma [ 6 ]

Location

TSS1500 (cg24079038)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.48E+00 Statistic Test p-value:5.82E-10; Z-score:-1.78E+00

Methylation in Case

2.97E-01 (Median) Methylation in Control 4.39E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC47A1 in pancretic ductal adenocarcinoma [ 6 ]

Location

TSS1500 (cg18646365)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.36E+00 Statistic Test p-value:1.57E-08; Z-score:1.31E+00

Methylation in Case

3.98E-01 (Median) Methylation in Control 2.93E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC47A1 in pancretic ductal adenocarcinoma [ 6 ]

Location

TSS200 (cg06750832)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:5.47E+00 Statistic Test p-value:3.34E-33; Z-score:5.41E+00

Methylation in Case

4.26E-01 (Median) Methylation in Control 7.79E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC47A1 in pancretic ductal adenocarcinoma [ 6 ]

Location

Body (cg14994247)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.21E+00 Statistic Test p-value:2.01E-20; Z-score:-2.74E+00

Methylation in Case

3.94E-01 (Median) Methylation in Control 4.76E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC47A1 in pancretic ductal adenocarcinoma [ 6 ]

Location

Body (cg04320476)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:7.13E-09; Z-score:-1.61E+00

Methylation in Case

7.94E-01 (Median) Methylation in Control 8.67E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC47A1 in pancretic ductal adenocarcinoma [ 6 ]

Location

Body (cg10605137)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:1.54E-05; Z-score:-9.81E-01

Methylation in Case

3.28E-01 (Median) Methylation in Control 3.61E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC47A1 in pancretic ductal adenocarcinoma [ 6 ]

Location

Body (cg04726373)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:1.65E-05; Z-score:-9.44E-01

Methylation in Case

7.20E-01 (Median) Methylation in Control 7.73E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC47A1 in pancretic ductal adenocarcinoma [ 6 ]

Location

Body (cg19866594)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.23E-05; Z-score:-3.92E-01

Methylation in Case

8.70E-01 (Median) Methylation in Control 8.78E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC47A1 in pancretic ductal adenocarcinoma [ 6 ]

Location

Body (cg13755144)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:2.94E-04; Z-score:5.86E-01

Methylation in Case

8.87E-01 (Median) Methylation in Control 8.68E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC47A1 in pancretic ductal adenocarcinoma [ 6 ]

Location

Body (cg00714531)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:1.25E-03; Z-score:6.19E-01

Methylation in Case

8.82E-01 (Median) Methylation in Control 8.47E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC47A1 in pancretic ductal adenocarcinoma [ 6 ]

Location

Body (cg26129353)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:1.62E-02; Z-score:-6.53E-01

Methylation in Case

7.43E-01 (Median) Methylation in Control 8.17E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC47A1 in pancretic ductal adenocarcinoma [ 6 ]

Location

Body (cg13405678)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:2.79E-02; Z-score:5.36E-01

Methylation in Case

5.86E-01 (Median) Methylation in Control 5.67E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC47A1 in pancretic ductal adenocarcinoma [ 6 ]

Location

Body (cg22288309)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.98E-02; Z-score:-1.32E-01

Methylation in Case

8.00E-01 (Median) Methylation in Control 8.06E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC47A1 in pancretic ductal adenocarcinoma [ 6 ]

Location

3'UTR (cg06566678)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:4.11E-06; Z-score:1.77E+00

Methylation in Case

8.55E-01 (Median) Methylation in Control 8.22E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Bladder cancer

         14 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC47A1 in bladder cancer [ 7 ]

Location

TSS1500 (cg01530032)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.33E+00 Statistic Test p-value:6.81E-07; Z-score:-4.41E+00

Methylation in Case

4.58E-01 (Median) Methylation in Control 6.10E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC47A1 in bladder cancer [ 7 ]

Location

TSS1500 (cg15971010)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.35E+00 Statistic Test p-value:4.06E-02; Z-score:2.06E+00

Methylation in Case

3.92E-01 (Median) Methylation in Control 2.90E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC47A1 in bladder cancer [ 7 ]

Location

TSS200 (cg13004927)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.67E+00 Statistic Test p-value:3.00E-03; Z-score:1.60E+00

Methylation in Case

5.99E-02 (Median) Methylation in Control 3.59E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC47A1 in bladder cancer [ 7 ]

Location

TSS200 (cg07829432)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:3.22E-02; Z-score:4.08E-01

Methylation in Case

1.18E-01 (Median) Methylation in Control 1.10E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC47A1 in bladder cancer [ 7 ]

Location

TSS200 (cg15014549)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:4.71E-02; Z-score:-7.98E-02

Methylation in Case

9.52E-02 (Median) Methylation in Control 9.62E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC47A1 in bladder cancer [ 7 ]

Location

Body (cg24151087)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.86E+00 Statistic Test p-value:6.51E-16; Z-score:-2.13E+01

Methylation in Case

1.40E-01 (Median) Methylation in Control 4.01E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC47A1 in bladder cancer [ 7 ]

Location

Body (cg04308167)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.84E+00 Statistic Test p-value:1.65E-08; Z-score:-7.26E+00

Methylation in Case

3.43E-01 (Median) Methylation in Control 6.32E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC47A1 in bladder cancer [ 7 ]

Location

Body (cg12799818)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-3.91E+00 Statistic Test p-value:1.22E-07; Z-score:-7.78E+00

Methylation in Case

8.98E-02 (Median) Methylation in Control 3.51E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC47A1 in bladder cancer [ 7 ]

Location

Body (cg08895056)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.32E+00 Statistic Test p-value:4.88E-07; Z-score:-4.70E+00

Methylation in Case

5.41E-01 (Median) Methylation in Control 7.15E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC47A1 in bladder cancer [ 7 ]

Location

Body (cg10718608)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.35E+00 Statistic Test p-value:1.43E-05; Z-score:-5.59E+00

Methylation in Case

5.02E-01 (Median) Methylation in Control 6.75E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC47A1 in bladder cancer [ 7 ]

Location

Body (cg20930201)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.46E+00 Statistic Test p-value:2.90E-04; Z-score:7.75E+00

Methylation in Case

2.29E-01 (Median) Methylation in Control 1.57E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC47A1 in bladder cancer [ 7 ]

Location

Body (cg26959235)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.44E+00 Statistic Test p-value:2.52E-03; Z-score:2.84E+00

Methylation in Case

1.58E-01 (Median) Methylation in Control 1.09E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC47A1 in bladder cancer [ 7 ]

Location

Body (cg16887170)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:2.74E-03; Z-score:-2.16E+00

Methylation in Case

7.06E-01 (Median) Methylation in Control 7.85E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC47A1 in bladder cancer [ 7 ]

Location

Body (cg17332016)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.27E+00 Statistic Test p-value:1.14E-02; Z-score:9.85E-01

Methylation in Case

5.12E-02 (Median) Methylation in Control 4.02E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

         15 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC47A1 in breast cancer [ 8 ]

Location

TSS1500 (cg15971010)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.35E+00 Statistic Test p-value:2.21E-07; Z-score:1.10E+00

Methylation in Case

2.49E-01 (Median) Methylation in Control 1.85E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC47A1 in breast cancer [ 8 ]

Location

TSS1500 (cg21692194)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.22E+00 Statistic Test p-value:6.56E-06; Z-score:8.36E-01

Methylation in Case

1.73E-01 (Median) Methylation in Control 1.42E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC47A1 in breast cancer [ 8 ]

Location

TSS1500 (cg25387636)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.39E+00 Statistic Test p-value:1.52E-05; Z-score:1.00E+00

Methylation in Case

1.40E-01 (Median) Methylation in Control 1.00E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC47A1 in breast cancer [ 8 ]

Location

TSS1500 (cg01530032)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:2.09E-04; Z-score:-1.21E+00

Methylation in Case

5.58E-01 (Median) Methylation in Control 6.35E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC47A1 in breast cancer [ 8 ]

Location

TSS1500 (cg12133118)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:3.78E-02; Z-score:-7.59E-01

Methylation in Case

5.23E-01 (Median) Methylation in Control 5.65E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC47A1 in breast cancer [ 8 ]

Location

TSS200 (cg07829432)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.22E+00 Statistic Test p-value:1.95E-05; Z-score:8.84E-01

Methylation in Case

1.07E-01 (Median) Methylation in Control 8.72E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC47A1 in breast cancer [ 8 ]

Location

TSS200 (cg13004927)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.35E+00 Statistic Test p-value:5.95E-04; Z-score:3.49E-01

Methylation in Case

3.88E-02 (Median) Methylation in Control 2.88E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC47A1 in breast cancer [ 8 ]

Location

TSS200 (cg15014549)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:6.71E-03; Z-score:4.96E-01

Methylation in Case

7.76E-02 (Median) Methylation in Control 6.84E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC47A1 in breast cancer [ 8 ]

Location

Body (cg08895056)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.28E+00 Statistic Test p-value:8.26E-13; Z-score:-2.23E+00

Methylation in Case

5.37E-01 (Median) Methylation in Control 6.88E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC47A1 in breast cancer [ 8 ]

Location

Body (cg20930201)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.45E+00 Statistic Test p-value:1.40E-10; Z-score:2.48E+00

Methylation in Case

2.07E-01 (Median) Methylation in Control 1.43E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC47A1 in breast cancer [ 8 ]

Location

Body (cg10718608)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:7.64E-08; Z-score:-1.82E+00

Methylation in Case

5.62E-01 (Median) Methylation in Control 6.67E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC47A1 in breast cancer [ 8 ]

Location

Body (cg04308167)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.27E+00 Statistic Test p-value:1.27E-07; Z-score:-1.55E+00

Methylation in Case

4.38E-01 (Median) Methylation in Control 5.57E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC47A1 in breast cancer [ 8 ]

Location

Body (cg16887170)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.26E+00 Statistic Test p-value:4.94E-04; Z-score:-1.23E+00

Methylation in Case

6.20E-01 (Median) Methylation in Control 7.83E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC47A1 in breast cancer [ 8 ]

Location

Body (cg26959235)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:5.02E-04; Z-score:4.52E-01

Methylation in Case

1.29E-01 (Median) Methylation in Control 1.18E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC47A1 in breast cancer [ 8 ]

Location

Body (cg17332016)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:2.52E-03; Z-score:1.73E-01

Methylation in Case

4.83E-02 (Median) Methylation in Control 4.55E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Celiac disease

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC47A1 in celiac disease [ 9 ]

Location

TSS1500 (cg21692194)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.61E+00 Statistic Test p-value:1.38E-03; Z-score:1.91E+00

Methylation in Case

2.10E-01 (Median) Methylation in Control 1.31E-01 (Median)

Studied Phenotype

Celiac disease[ ICD-11:DA95]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC47A1 in celiac disease [ 9 ]

Location

TSS1500 (cg25387636)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.84E+00 Statistic Test p-value:3.58E-02; Z-score:5.26E-01

Methylation in Case

9.86E-02 (Median) Methylation in Control 5.37E-02 (Median)

Studied Phenotype

Celiac disease[ ICD-11:DA95]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC47A1 in celiac disease [ 9 ]

Location

Body (cg16887170)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.22E+00 Statistic Test p-value:3.07E-02; Z-score:-1.14E+00

Methylation in Case

7.01E-01 (Median) Methylation in Control 8.55E-01 (Median)

Studied Phenotype

Celiac disease[ ICD-11:DA95]

Experimental Material

Patient tissue samples

  Colorectal cancer

         18 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC47A1 in colorectal cancer [ 10 ]

Location

TSS1500 (cg15971010)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.20E+00 Statistic Test p-value:1.59E-12; Z-score:4.44E+00

Methylation in Case

4.89E-01 (Median) Methylation in Control 2.22E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC47A1 in colorectal cancer [ 10 ]

Location

TSS1500 (cg25387636)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.95E+00 Statistic Test p-value:2.49E-11; Z-score:6.62E+00

Methylation in Case

3.66E-01 (Median) Methylation in Control 1.24E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC47A1 in colorectal cancer [ 10 ]

Location

TSS1500 (cg21692194)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.91E+00 Statistic Test p-value:1.67E-09; Z-score:3.73E+00

Methylation in Case

3.04E-01 (Median) Methylation in Control 1.59E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC47A1 in colorectal cancer [ 10 ]

Location

TSS1500 (cg01530032)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:1.31E-08; Z-score:-2.16E+00

Methylation in Case

7.03E-01 (Median) Methylation in Control 7.80E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC47A1 in colorectal cancer [ 10 ]

Location

TSS200 (cg07829432)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.82E+00 Statistic Test p-value:2.59E-09; Z-score:3.90E+00

Methylation in Case

3.13E-01 (Median) Methylation in Control 1.71E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC47A1 in colorectal cancer [ 10 ]

Location

TSS200 (cg15014549)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.64E+00 Statistic Test p-value:1.01E-08; Z-score:3.34E+00

Methylation in Case

1.91E-01 (Median) Methylation in Control 1.17E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC47A1 in colorectal cancer [ 10 ]

Location

TSS200 (cg13004927)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.17E+00 Statistic Test p-value:3.99E-08; Z-score:1.58E+00

Methylation in Case

6.96E-02 (Median) Methylation in Control 3.21E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC47A1 in colorectal cancer [ 10 ]

Location

Body (cg24151087)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.34E+00 Statistic Test p-value:1.12E-06; Z-score:1.88E+00

Methylation in Case

4.17E-01 (Median) Methylation in Control 3.12E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC47A1 in colorectal cancer [ 10 ]

Location

Body (cg26959235)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.29E+00 Statistic Test p-value:1.15E-06; Z-score:1.32E+00

Methylation in Case

1.71E-01 (Median) Methylation in Control 1.32E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC47A1 in colorectal cancer [ 10 ]

Location

Body (cg04308167)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:2.25E-06; Z-score:-1.17E+00

Methylation in Case

7.72E-01 (Median) Methylation in Control 8.29E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC47A1 in colorectal cancer [ 10 ]

Location

Body (cg20930201)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.40E+00 Statistic Test p-value:3.29E-06; Z-score:1.80E+00

Methylation in Case

3.26E-01 (Median) Methylation in Control 2.34E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC47A1 in colorectal cancer [ 10 ]

Location

Body (cg17332016)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:7.25E-05; Z-score:2.14E-01

Methylation in Case

1.37E-01 (Median) Methylation in Control 1.32E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC47A1 in colorectal cancer [ 10 ]

Location

Body (cg10718608)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:5.08E-04; Z-score:-7.26E-01

Methylation in Case

8.24E-01 (Median) Methylation in Control 8.62E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC47A1 in colorectal cancer [ 10 ]

Location

Body (cg11784214)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:8.98E-04; Z-score:-9.82E-01

Methylation in Case

9.32E-01 (Median) Methylation in Control 9.41E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC47A1 in colorectal cancer [ 10 ]

Location

Body (cg08895056)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:9.10E-04; Z-score:-6.30E-01

Methylation in Case

7.92E-01 (Median) Methylation in Control 8.20E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC47A1 in colorectal cancer [ 10 ]

Location

Body (cg16887170)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.94E-02; Z-score:-4.04E-01

Methylation in Case

8.71E-01 (Median) Methylation in Control 8.81E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC47A1 in colorectal cancer [ 10 ]

Location

Body (cg12799818)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:4.17E-02; Z-score:9.34E-02

Methylation in Case

2.71E-01 (Median) Methylation in Control 2.67E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  HIV infection

         11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC47A1 in HIV infection [ 11 ]

Location

TSS1500 (cg15971010)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.25E+00 Statistic Test p-value:4.88E-03; Z-score:6.76E-01

Methylation in Case

1.70E-01 (Median) Methylation in Control 1.36E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC47A1 in HIV infection [ 11 ]

Location

TSS1500 (cg25387636)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.32E+00 Statistic Test p-value:5.93E-03; Z-score:9.43E-01

Methylation in Case

9.77E-02 (Median) Methylation in Control 7.37E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC47A1 in HIV infection [ 11 ]

Location

TSS200 (cg07829432)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.34E+00 Statistic Test p-value:1.21E-04; Z-score:1.43E+00

Methylation in Case

1.14E-01 (Median) Methylation in Control 8.46E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC47A1 in HIV infection [ 11 ]

Location

TSS200 (cg13004927)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.65E+00 Statistic Test p-value:1.73E-03; Z-score:2.20E+00

Methylation in Case

4.52E-02 (Median) Methylation in Control 1.71E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC47A1 in HIV infection [ 11 ]

Location

Body (cg24151087)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.49E+00 Statistic Test p-value:2.12E-06; Z-score:2.25E+00

Methylation in Case

1.91E-01 (Median) Methylation in Control 1.28E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC47A1 in HIV infection [ 11 ]

Location

Body (cg16887170)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:1.11E-05; Z-score:-2.19E+00

Methylation in Case

7.61E-01 (Median) Methylation in Control 8.36E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC47A1 in HIV infection [ 11 ]

Location

Body (cg12799818)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.50E+00 Statistic Test p-value:2.09E-05; Z-score:1.85E+00

Methylation in Case

8.68E-02 (Median) Methylation in Control 5.78E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC47A1 in HIV infection [ 11 ]

Location

Body (cg20930201)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.34E+00 Statistic Test p-value:4.18E-05; Z-score:2.31E+00

Methylation in Case

2.32E-01 (Median) Methylation in Control 1.74E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC47A1 in HIV infection [ 11 ]

Location

Body (cg12894055)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.25E+00 Statistic Test p-value:4.43E-04; Z-score:8.90E-01

Methylation in Case

5.22E-02 (Median) Methylation in Control 4.18E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC47A1 in HIV infection [ 11 ]

Location

Body (cg26959235)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.19E+00 Statistic Test p-value:1.57E-02; Z-score:7.72E-01

Methylation in Case

1.45E-01 (Median) Methylation in Control 1.22E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC47A1 in HIV infection [ 11 ]

Location

Body (cg10718608)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.18E+00 Statistic Test p-value:3.00E-02; Z-score:1.30E+00

Methylation in Case

3.15E-01 (Median) Methylation in Control 2.67E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Prostate cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC47A1 in prostate cancer [ 12 ]

Location

TSS1500 (cg20533553)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.22E+00 Statistic Test p-value:2.38E-02; Z-score:2.62E+00

Methylation in Case

7.79E-01 (Median) Methylation in Control 6.38E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC47A1 in prostate cancer [ 12 ]

Location

Body (cg08874645)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.17E+00 Statistic Test p-value:1.34E-02; Z-score:1.88E+00

Methylation in Case

8.36E-01 (Median) Methylation in Control 7.15E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

           7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC47A1 in clear cell renal cell carcinoma [ 13 ]

Location

TSS200 (cg15014549)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:1.50E-02; Z-score:5.02E-01

Methylation in Case

3.47E-02 (Median) Methylation in Control 3.06E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC47A1 in clear cell renal cell carcinoma [ 13 ]

Location

TSS200 (cg07829432)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:3.16E-02; Z-score:2.64E-01

Methylation in Case

3.80E-02 (Median) Methylation in Control 3.34E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC47A1 in clear cell renal cell carcinoma [ 13 ]

Location

Body (cg12894055)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.41E+00 Statistic Test p-value:6.34E-08; Z-score:-2.52E+00

Methylation in Case

5.62E-02 (Median) Methylation in Control 1.35E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC47A1 in clear cell renal cell carcinoma [ 13 ]

Location

Body (cg10718608)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.32E+00 Statistic Test p-value:3.14E-07; Z-score:-3.83E+00

Methylation in Case

5.26E-01 (Median) Methylation in Control 6.94E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC47A1 in clear cell renal cell carcinoma [ 13 ]

Location

Body (cg08895056)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.32E+00 Statistic Test p-value:1.59E-06; Z-score:-3.32E+00

Methylation in Case

5.11E-01 (Median) Methylation in Control 6.73E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC47A1 in clear cell renal cell carcinoma [ 13 ]

Location

Body (cg20930201)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.36E+00 Statistic Test p-value:4.54E-03; Z-score:9.20E-01

Methylation in Case

1.07E-01 (Median) Methylation in Control 7.89E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC47A1 in clear cell renal cell carcinoma [ 13 ]

Location

3'UTR (cg12550399)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:2.75E-03; Z-score:2.21E+00

Methylation in Case

8.54E-01 (Median) Methylation in Control 7.64E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC47A1 in lung adenocarcinoma [ 14 ]

Location

TSS200 (cg07829432)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.46E+00 Statistic Test p-value:3.51E-03; Z-score:3.46E+00

Methylation in Case

1.84E-01 (Median) Methylation in Control 1.26E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC47A1 in lung adenocarcinoma [ 14 ]

Location

TSS200 (cg15014549)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.20E+00 Statistic Test p-value:7.76E-03; Z-score:2.65E+00

Methylation in Case

1.25E-01 (Median) Methylation in Control 1.04E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC47A1 in lung adenocarcinoma [ 14 ]

Location

TSS200 (cg13004927)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.62E+00 Statistic Test p-value:4.44E-02; Z-score:1.78E+00

Methylation in Case

7.07E-02 (Median) Methylation in Control 4.38E-02 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC47A1 in lung adenocarcinoma [ 14 ]

Location

Body (cg10718608)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.29E+00 Statistic Test p-value:5.10E-05; Z-score:-3.35E+00

Methylation in Case

4.90E-01 (Median) Methylation in Control 6.34E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC47A1 in lung adenocarcinoma [ 14 ]

Location

Body (cg08895056)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.23E+00 Statistic Test p-value:1.04E-04; Z-score:-2.47E+00

Methylation in Case

5.25E-01 (Median) Methylation in Control 6.48E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC47A1 in lung adenocarcinoma [ 14 ]

Location

Body (cg12894055)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.49E+00 Statistic Test p-value:5.84E-03; Z-score:-1.48E+00

Methylation in Case

1.49E-01 (Median) Methylation in Control 2.22E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC47A1 in lung adenocarcinoma [ 14 ]

Location

Body (cg16887170)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:7.22E-03; Z-score:-1.53E+00

Methylation in Case

7.68E-01 (Median) Methylation in Control 8.13E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC47A1 in lung adenocarcinoma [ 14 ]

Location

Body (cg20930201)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:2.61E-02; Z-score:1.29E+00

Methylation in Case

2.47E-01 (Median) Methylation in Control 2.13E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Panic disorder

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC47A1 in panic disorder [ 15 ]

Location

TSS200 (cg15014549)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:9.75E-01 Statistic Test p-value:6.59E-03; Z-score:3.02E-01

Methylation in Case

-4.09E+00 (Median) Methylation in Control -4.19E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC47A1 in panic disorder [ 15 ]

Location

Body (cg17332016)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-9.80E-01 Statistic Test p-value:2.59E-02; Z-score:-3.18E-01

Methylation in Case

-5.20E+00 (Median) Methylation in Control -5.10E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC47A1 in panic disorder [ 15 ]

Location

Body (cg10718608)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:9.46E-01 Statistic Test p-value:4.36E-02; Z-score:3.36E-01

Methylation in Case

-1.97E+00 (Median) Methylation in Control -2.09E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

           7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC47A1 in atypical teratoid rhabdoid tumor [ 16 ]

Location

Body (cg04308167)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.29E+00 Statistic Test p-value:6.87E-04; Z-score:-9.00E-01

Methylation in Case

3.86E-01 (Median) Methylation in Control 4.96E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC47A1 in atypical teratoid rhabdoid tumor [ 16 ]

Location

Body (cg08895056)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:8.62E-03; Z-score:4.86E-01

Methylation in Case

9.34E-01 (Median) Methylation in Control 9.02E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC47A1 in atypical teratoid rhabdoid tumor [ 16 ]

Location

Body (cg10718608)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:1.75E-02; Z-score:-3.83E-01

Methylation in Case

7.59E-01 (Median) Methylation in Control 7.96E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC47A1 in atypical teratoid rhabdoid tumor [ 16 ]

Location

Body (cg11784214)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.51E+00 Statistic Test p-value:2.49E-02; Z-score:-6.29E-01

Methylation in Case

1.74E-01 (Median) Methylation in Control 2.62E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC47A1 in atypical teratoid rhabdoid tumor [ 16 ]

Location

Body (cg12799818)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.22E+00 Statistic Test p-value:2.97E-02; Z-score:8.34E-01

Methylation in Case

6.40E-01 (Median) Methylation in Control 5.27E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC47A1 in atypical teratoid rhabdoid tumor [ 16 ]

Location

Body (cg12894055)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:3.11E-02; Z-score:3.82E-01

Methylation in Case

8.83E-01 (Median) Methylation in Control 8.39E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC47A1 in atypical teratoid rhabdoid tumor [ 16 ]

Location

3'UTR (cg12550399)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.60E+00 Statistic Test p-value:1.55E-11; Z-score:-1.75E+00

Methylation in Case

2.62E-01 (Median) Methylation in Control 4.19E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Depression

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC47A1 in depression [ 17 ]

Location

Body (cg16887170)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.07E-03; Z-score:-6.47E-01

Methylation in Case

7.63E-01 (Median) Methylation in Control 7.80E-01 (Median)

Studied Phenotype

Depression[ ICD-11:6A8Z]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC47A1 in papillary thyroid cancer [ 18 ]

Location

Body (cg12894055)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.65E+00 Statistic Test p-value:2.07E-17; Z-score:-1.68E+00

Methylation in Case

9.77E-02 (Median) Methylation in Control 1.61E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC47A1 in papillary thyroid cancer [ 18 ]

Location

Body (cg26959235)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.26E+00 Statistic Test p-value:5.83E-16; Z-score:-1.96E+00

Methylation in Case

1.52E-01 (Median) Methylation in Control 1.91E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC47A1 in papillary thyroid cancer [ 18 ]

Location

Body (cg24151087)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.32E+00 Statistic Test p-value:1.46E-13; Z-score:-2.20E+00

Methylation in Case

4.10E-01 (Median) Methylation in Control 5.41E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC47A1 in papillary thyroid cancer [ 18 ]

Location

Body (cg08895056)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.32E+00 Statistic Test p-value:3.58E-12; Z-score:-1.97E+00

Methylation in Case

3.56E-01 (Median) Methylation in Control 4.70E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC47A1 in papillary thyroid cancer [ 18 ]

Location

Body (cg10718608)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.25E+00 Statistic Test p-value:1.10E-10; Z-score:-1.78E+00

Methylation in Case

3.68E-01 (Median) Methylation in Control 4.60E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC47A1 in papillary thyroid cancer [ 18 ]

Location

Body (cg12799818)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.34E+00 Statistic Test p-value:3.35E-07; Z-score:-1.56E+00

Methylation in Case

2.92E-01 (Median) Methylation in Control 3.90E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC47A1 in papillary thyroid cancer [ 18 ]

Location

Body (cg17332016)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:1.43E-03; Z-score:-4.84E-01

Methylation in Case

4.25E-02 (Median) Methylation in Control 4.68E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC47A1 in papillary thyroid cancer [ 18 ]

Location

Body (cg04308167)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.31E-02; Z-score:-4.65E-01

Methylation in Case

7.60E-01 (Median) Methylation in Control 7.85E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC47A1 in systemic lupus erythematosus [ 19 ]

Location

Body (cg04308167)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:6.32E-03; Z-score:-3.99E-01

Methylation in Case

4.89E-01 (Median) Methylation in Control 5.44E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC47A1 in systemic lupus erythematosus [ 19 ]

Location

Body (cg11784214)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.40E-02; Z-score:-1.44E-01

Methylation in Case

8.30E-01 (Median) Methylation in Control 8.35E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC47A1 in systemic lupus erythematosus [ 19 ]

Location

Body (cg12894055)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:1.79E-02; Z-score:-1.01E-01

Methylation in Case

7.10E-02 (Median) Methylation in Control 7.53E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC47A1 in systemic lupus erythematosus [ 19 ]

Location

Body (cg16887170)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:3.38E-02; Z-score:-8.87E-02

Methylation in Case

7.87E-01 (Median) Methylation in Control 7.94E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Gastric cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate/moderate hypermethylation of SLC47A1 in gastric cancer than that in healthy individual/adjacent tissue

Studied Phenotype

Gastric cancer [ICD-11:2B72]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:4.98E-15; Fold-change:0.209868716; Z-score:1.624788814

The Methylation Level of Disease Section Compare with the Adjacent Tissue

p-value:8.21E-66; Fold-change:0.284929054; Z-score:170.8903475
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals

  Prostate cancer metastasis

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypermethylation of SLC47A1 in prostate cancer metastasis than that in healthy individual

Studied Phenotype

Prostate cancer metastasis [ICD-11:2.00E+06]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.037135313; Fold-change:0.242405384; Z-score:9.410363493
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

microRNA

  Unclear Phenotype

         52 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-1275 directly targets SLC47A1 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1275 miRNA Mature ID miR-1275

miRNA Sequence

GUGGGGGAGAGGCUGUC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon2

miR-1307 directly targets SLC47A1 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1307 miRNA Mature ID miR-1307-3p

miRNA Sequence

ACUCGGCGUGGCGUCGGUCGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-1343 directly targets SLC47A1 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1343 miRNA Mature ID miR-1343-5p

miRNA Sequence

UGGGGAGCGGCCCCCGGGUGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-149 directly targets SLC47A1 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-149 miRNA Mature ID miR-149-3p

miRNA Sequence

AGGGAGGGACGGGGGCUGUGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon5

miR-181d directly targets SLC47A1 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-181d miRNA Mature ID miR-181d-3p

miRNA Sequence

CCACCGGGGGAUGAAUGUCAC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon6

miR-1908 directly targets SLC47A1 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1908 miRNA Mature ID miR-1908-5p

miRNA Sequence

CGGCGGGGACGGCGAUUGGUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-212 directly targets SLC47A1 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-212 miRNA Mature ID miR-212-5p

miRNA Sequence

ACCUUGGCUCUAGACUGCUUACU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-3144 directly targets SLC47A1 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3144 miRNA Mature ID miR-3144-5p

miRNA Sequence

AGGGGACCAAAGAGAUAUAUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon9

miR-3189 directly targets SLC47A1 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3189 miRNA Mature ID miR-3189-3p

miRNA Sequence

CCCUUGGGUCUGAUGGGGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-326 directly targets SLC47A1 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-326 miRNA Mature ID miR-326

miRNA Sequence

CCUCUGGGCCCUUCCUCCAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon11

miR-330 directly targets SLC47A1 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-330 miRNA Mature ID miR-330-5p

miRNA Sequence

UCUCUGGGCCUGUGUCUUAGGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon12

miR-3616 directly targets SLC47A1 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3616 miRNA Mature ID miR-3616-3p

miRNA Sequence

CGAGGGCAUUUCAUGAUGCAGGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon13

miR-3960 directly targets SLC47A1 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3960 miRNA Mature ID miR-3960

miRNA Sequence

GGCGGCGGCGGAGGCGGGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon14

miR-4300 directly targets SLC47A1 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4300 miRNA Mature ID miR-4300

miRNA Sequence

UGGGAGCUGGACUACUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon15

miR-4467 directly targets SLC47A1 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4467 miRNA Mature ID miR-4467

miRNA Sequence

UGGCGGCGGUAGUUAUGGGCUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon16

miR-4525 directly targets SLC47A1 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4525 miRNA Mature ID miR-4525

miRNA Sequence

GGGGGGAUGUGCAUGCUGGUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon17

miR-4655 directly targets SLC47A1 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4655 miRNA Mature ID miR-4655-5p

miRNA Sequence

CACCGGGGAUGGCAGAGGGUCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon18

miR-4665 directly targets SLC47A1 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4665 miRNA Mature ID miR-4665-5p

miRNA Sequence

CUGGGGGACGCGUGAGCGCGAGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon19

miR-4667 directly targets SLC47A1 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4667 miRNA Mature ID miR-4667-5p

miRNA Sequence

ACUGGGGAGCAGAAGGAGAACC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon20

miR-4680 directly targets SLC47A1 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4680 miRNA Mature ID miR-4680-5p

miRNA Sequence

AGAACUCUUGCAGUCUUAGAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon21

miR-4700 directly targets SLC47A1 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4700 miRNA Mature ID miR-4700-5p

miRNA Sequence

UCUGGGGAUGAGGACAGUGUGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon22

miR-4706 directly targets SLC47A1 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4706 miRNA Mature ID miR-4706

miRNA Sequence

AGCGGGGAGGAAGUGGGCGCUGCUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon23

miR-4723 directly targets SLC47A1 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4723 miRNA Mature ID miR-4723-5p

miRNA Sequence

UGGGGGAGCCAUGAGAUAAGAGCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon24

miR-4728 directly targets SLC47A1 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4728 miRNA Mature ID miR-4728-5p

miRNA Sequence

UGGGAGGGGAGAGGCAGCAAGCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon25

miR-4730 directly targets SLC47A1 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4730 miRNA Mature ID miR-4730

miRNA Sequence

CUGGCGGAGCCCAUUCCAUGCCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon26

miR-4749 directly targets SLC47A1 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4749 miRNA Mature ID miR-4749-5p

miRNA Sequence

UGCGGGGACAGGCCAGGGCAUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon27

miR-5008 directly targets SLC47A1 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5008 miRNA Mature ID miR-5008-5p

miRNA Sequence

UGAGGCCCUUGGGGCACAGUGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon28

miR-5010 directly targets SLC47A1 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5010 miRNA Mature ID miR-5010-5p

miRNA Sequence

AGGGGGAUGGCAGAGCAAAAUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon29

miR-514a directly targets SLC47A1 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-514a miRNA Mature ID miR-514a-5p

miRNA Sequence

UACUCUGGAGAGUGACAAUCAUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon30

miR-5591 directly targets SLC47A1 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5591 miRNA Mature ID miR-5591-5p

miRNA Sequence

UGGGAGCUAAGCUAUGGGUAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon31

miR-5698 directly targets SLC47A1 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5698 miRNA Mature ID miR-5698

miRNA Sequence

UGGGGGAGUGCAGUGAUUGUGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon32

miR-625 directly targets SLC47A1 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-625 miRNA Mature ID miR-625-5p

miRNA Sequence

AGGGGGAAAGUUCUAUAGUCC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon33

miR-637 directly targets SLC47A1 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-637 miRNA Mature ID miR-637

miRNA Sequence

ACUGGGGGCUUUCGGGCUCUGCGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon34

miR-663a directly targets SLC47A1 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-663a miRNA Mature ID miR-663a

miRNA Sequence

AGGCGGGGCGCCGCGGGACCGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon35

miR-6726 directly targets SLC47A1 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6726 miRNA Mature ID miR-6726-5p

miRNA Sequence

CGGGAGCUGGGGUCUGCAGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon36

miR-6770 directly targets SLC47A1 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6770 miRNA Mature ID miR-6770-3p

miRNA Sequence

CUGGCGGCUGUGUCUUCACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon37

miR-6777 directly targets SLC47A1 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6777 miRNA Mature ID miR-6777-5p

miRNA Sequence

ACGGGGAGUCAGGCAGUGGUGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon38

miR-6784 directly targets SLC47A1 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6784 miRNA Mature ID miR-6784-5p

miRNA Sequence

GCCGGGGCUUUGGGUGAGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon39

miR-6785 directly targets SLC47A1 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6785 miRNA Mature ID miR-6785-5p

miRNA Sequence

UGGGAGGGCGUGGAUGAUGGUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon40

miR-6787 directly targets SLC47A1 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6787 miRNA Mature ID miR-6787-5p

miRNA Sequence

UGGCGGGGGUAGAGCUGGCUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon41

miR-6825 directly targets SLC47A1 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6825 miRNA Mature ID miR-6825-5p

miRNA Sequence

UGGGGAGGUGUGGAGUCAGCAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon42

miR-6851 directly targets SLC47A1 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6851 miRNA Mature ID miR-6851-3p

miRNA Sequence

UGGCCCUUUGUACCCCUCCAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon43

miR-6870 directly targets SLC47A1 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6870 miRNA Mature ID miR-6870-5p

miRNA Sequence

UGGGGGAGAUGGGGGUUGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon44

miR-6883 directly targets SLC47A1 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6883 miRNA Mature ID miR-6883-5p

miRNA Sequence

AGGGAGGGUGUGGUAUGGAUGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon45

miR-6889 directly targets SLC47A1 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6889 miRNA Mature ID miR-6889-5p

miRNA Sequence

UCGGGGAGUCUGGGGUCCGGAAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon46

miR-7111 directly targets SLC47A1 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7111 miRNA Mature ID miR-7111-5p

miRNA Sequence

UGGGGGAGGAAGGACAGGCCAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon47

miR-7155 directly targets SLC47A1 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7155 miRNA Mature ID miR-7155-5p

miRNA Sequence

UCUGGGGUCUUGGGCCAUC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon48

miR-7160 directly targets SLC47A1 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7160 miRNA Mature ID miR-7160-3p

miRNA Sequence

CAGGGCCCUGGCUUUAGCAGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon49

miR-8072 directly targets SLC47A1 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-8072 miRNA Mature ID miR-8072

miRNA Sequence

GGCGGCGGGGAGGUAGGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon50

miR-8089 directly targets SLC47A1 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-8089 miRNA Mature ID miR-8089

miRNA Sequence

CCUGGGGACAGGGGAUUGGGGCAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon51

miR-920 directly targets SLC47A1 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-920 miRNA Mature ID miR-920

miRNA Sequence

GGGGAGCUGUGGAAGCAGUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon52

miR-939 directly targets SLC47A1 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-939 miRNA Mature ID miR-939-5p

miRNA Sequence

UGGGGAGCUGAGGCUCUGGGGGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Human liver tissue

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-95 regulates SLC47A1 expression [ 22 ]

Epigenetic Type

microRNA Experiment Method Taqman OpenArray Human miRNA Panel

miRNA Stemloop ID

miR-95 miRNA Mature ID miR-95-5p

miRNA Sequence

UCAAUAAAUGUCUGUUGAAUU

miRNA Target Type

Undirect

Studied Phenotype

Human liver tissue

Experimental Material

Patient tissue samples

Additional Notes

The effects of rifampin on four uptake drug transporters SLC47A1 were negatively correlated with the rifampin effects on miR-95 expression(r=-0.79, p=0.0048).
References
1 Diabetes medication associates with DNA methylation of metformin transporter genes in the human liver. Clin Epigenetics. 2017 Sep 21;9:102.
2 Relationship between DNA Methylation in the 5' CpG Island of the SLC47A1 (Multidrug and Toxin Extrusion Protein MATE1) Gene and Interindividual Variability in MATE1 Expression in the Human Liver. Mol Pharmacol. 2018 Jan;93(1):1-7.
3 A targeted analysis reveals relevant shifts in the methylation and transcription of genes responsible for bile acid homeostasis and drug metabolism in non-alcoholic fatty liver disease. BMC Genomics. 2016 Jun 14;17:462.
4 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
7 DNA Methylation Dynamics in Urological Tumors.
8 Genome-wide Scan for Methylation Profiles in Breast Cancer
9 The methylome of the celiac intestinal epithelium harbours genotype-independent alterations in the HLA region. Mol Ther Oncolytics. 2019 Feb 5;12:235-245.
10 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
11 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
12 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
13 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
14 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
15 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
16 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
17 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
18 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
19 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
20 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
21 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
22 Rifampin Regulation of Drug Transporters Gene Expression and the Association of MicroRNAs in Human Hepatocytes. Front Pharmacol. 2016 Apr 26;7:111.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.