Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0005 Transporter Info | ||||
| Gene Name | SLC22A7 | ||||
| Transporter Name | Organic anion transporter 2 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Histone acetylation |
|||||
|
Hepatocellular carcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Hypoacetylation of SLC22A7 in Hepatocellular carcinoma (compare with non-tumor adjacent tissue) | [ 1 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Histone acetylation | Experiment Method | RT-qPCR | ||
|
Related Molecular Changes | Down regulation ofSLC22A7 | Experiment Method | Western Blot | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Hepatocellular carcinoma cell lines (BEL-7402 and SMMC-7721) | ||||
|
Additional Notes |
Significant increases in SLC22A7 mRNA were observed when these cancer cells were cultured in the presence of histone deacetylase (HDAC) inhibitors. | ||||
|
Epigenetic Phenomenon2 |
Hypoacetylation of SLC22A7 in Hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Histone acetylation | Experiment Method | . | ||
|
Related Molecular Changes | Down regulation ofSLC22A7 | Experiment Method | RT-qPCR | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12] | ||||
|
Experimental Material |
SMMC-7721 HCC cells | ||||
|
Additional Notes |
Abnormal enrichment of sirtuin 7 (SIRT7), histone deacetylase 7 (HDAC7) and lysine acetyltransferase 8 (KAT8) at the promoter of OAT2 caused histone hypoacetylation and OAT2 downregulation. | ||||
|
microRNA |
|||||
|
Human liver tissue |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-29a-3p downregulates SLC22A7 expression in human liver cells | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Luciferase reporter assay | ||
|
Related Molecular Changes | Down regulation ofSLC22A7 | Experiment Method | Western Blot | ||
|
miRNA Stemloop ID |
miR-29a | miRNA Mature ID | miR-29a-3p | ||
|
miRNA Sequence |
UAGCACCAUCUGAAAUCGGUUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Studied Phenotype |
Human liver tissue | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Additional Notes |
Chemically-induced up-regulation of hsa-miR-29a-3p correlated inversely with the expression of SLC22A7. | ||||
|
Unclear Phenotype |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-29a directly targets SLC22A7 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | EMSA//Luciferase reporter assay//qRT-PCR//Western blot | ||
|
miRNA Stemloop ID |
miR-29a | miRNA Mature ID | miR-29a-3p | ||
|
miRNA Sequence |
UAGCACCAUCUGAAAUCGGUUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Methylation |
|||||
|
Lymphoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC22A7 in lymphoma than that in healthy individual | ||||
Studied Phenotype |
Lymphoma [ICD-11:2B30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:3.25E-16; Fold-change:-0.479825162; Z-score:-6.496538846 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.