General Information of Drug Transporter (DT)
DT ID DTD0001 Transporter Info
Gene Name ABCC1
Transporter Name Multidrug resistance-associated protein 1
Gene ID
4363
UniProt ID
P33527
Epigenetic Regulations of This DT (EGR)

Histone acetylation

  Breast cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Hypoacetylation of ABCC1 in Breast cancer [ 5 ]

Location

Promoter

Epigenetic Type

Histone acetylation Experiment Method .

Related Molecular Changes

Up regulation ofABCC1 Experiment Method RT-qPCR and Western blot

Studied Phenotype

Breast cancer[ ICD-11:2C60]

Experimental Material

T47D/SN120 and T47D/SN150 breast cancer sublines

Additional Notes

MRP1 overexpression in SN38-resistant T47D cells associated with the suppression of epigenetic gene silencing via DNA hypermethylation and histone deacetylation.

Methylation

  Cystic fibrosis

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Hypomethylation of ABCC1 in cystic fibrosis [ 1 ]

Location

Promoter (-612 to -317 bp)

Epigenetic Type

Methylation Experiment Method Methylation-specific PCR

Related Molecular Changes

Up regulation ofABCC1 Experiment Method RT-qPCR

Studied Phenotype

Cystic fibrosis[ ICD-11:CA25]

Experimental Material

Multiple cell lines of human

Additional Notes

Histone modifications rather than DNA methylation may play a role in regulating ABCC1 expression.

  Pancreatic cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Hypomethylation of ABCC1 in pancreatic cancer [ 2 ]

Location

Promoter

Epigenetic Type

Methylation Experiment Method Bisulfite sequencing

Related Molecular Changes

Up regulation ofABCC1 Experiment Method RT-qPCR

Studied Phenotype

Pancreatic cancer[ ICD-11:2C10]

Experimental Material

Multiple cell lines of human

Additional Notes

The expression of ABCC1 in human pancreatic cancer cells was not correlated with promoter demethylation.

  Breast cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Hypomethylation of ABCC1 in Breast cancer [ 5 ]

Location

Promoter

Epigenetic Type

Methylation Experiment Method .

Related Molecular Changes

Up regulation ofABCC1 Experiment Method RT-qPCR and Western blot

Studied Phenotype

Breast cancer[ ICD-11:2C60]

Experimental Material

T47D/SN120 and T47D/SN150 breast cancer sublines

Additional Notes

MRP1 overexpression in SN38-resistant T47D cells associated with the suppression of epigenetic gene silencing via DNA hypermethylation and histone deacetylation.

microRNA

  Breast cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Higher expression of miR-134 in breast cancer (compare to doxorubicin-resistance counterpart cells) [ 3 ]

Epigenetic Type

microRNA Experiment Method .

Related Molecular Changes

Down regulation ofABCC1 Experiment Method RT-qPCR

miRNA Stemloop ID

miR-134 miRNA Mature ID miR-134-3p

miRNA Sequence

CCUGUGGGCCACCUAGUCACCAA

miRNA Target Type

Direct

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Human breast adenocarcinoma cell line (MCF-7)

Additional Notes

MicroRNA-134 modulates resistance to doxorubicin in breast cancer cells by downregulating the expression of ABCC1.

  Small cell lung cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Higher expression of miR-7 in small cell lung cancer (compare with drug-resistant counterpart cells) [ 4 ]

Epigenetic Type

microRNA Experiment Method Luciferase reporter assay

Related Molecular Changes

Down regulation ofABCC1 Experiment Method RT-qPCR

miRNA Stemloop ID

miR-7 miRNA Mature ID miR-7-5p

miRNA Sequence

UGGAAGACUAGUGAUUUUGUUGUU

miRNA Target Type

Direct

Studied Phenotype

Small cell lung cancer[ ICD-11:2C25.1]

Experimental Material

Patient tissue samples

Additional Notes

miR-7 modulates chemoresistance of small cell lung cancer by repressing MRP1/ABCC1.

  Hepatocellular carcinoma

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-133a regulates ABCA1 expression [ 6 ]

Epigenetic Type

microRNA Experiment Method Luciferase reporter assay

Related Molecular Changes

Down regulation ofABCC1 Experiment Method RT-qPCR

miRNA Stemloop ID

miR-133a miRNA Mature ID miR-133a-5p

miRNA Sequence

AGCUGGUAAAAUGGAACCAAAU

miRNA Target Type

Direct

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Human hepatocellular carcinoma cell line (HepG2)

Additional Notes

The involvement of miR-133a in MDR is mediated by ABCC1 in hepatocellular carcinoma cell line HepG2 and suggested that miR-133a may be efficient agents for preventing and reversing ADM resistance in cancer cells.

  Epigenetic Phenomenon2

miR-133a regulates ABCA1 expression [ 6 ]

Epigenetic Type

microRNA Experiment Method Luciferase reporter assay

Related Molecular Changes

Down regulation ofABCC1 Experiment Method Western Blot

miRNA Stemloop ID

miR-133a miRNA Mature ID miR-133a-5p

miRNA Sequence

AGCUGGUAAAAUGGAACCAAAU

miRNA Target Type

Direct

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Human hepatocellular carcinoma cell line (HepG2)

Additional Notes

The involvement of miR-133a in MDR is mediated by ABCC1 in hepatocellular carcinoma cell line HepG2 and suggested that miR-133a may be efficient agents for preventing and reversing ADM resistance in cancer cells.

  Epigenetic Phenomenon3

miR-326 regulates ABCA1 expression [ 6 ]

Epigenetic Type

microRNA Experiment Method Luciferase reporter assay

Related Molecular Changes

Down regulation ofABCC1 Experiment Method Western Blot

miRNA Stemloop ID

miR-326 miRNA Mature ID miR-326

miRNA Sequence

CCUCUGGGCCCUUCCUCCAG

miRNA Target Type

Direct

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Human hepatocellular carcinoma cell line (HepG2)

Additional Notes

The involvement of miR-326 in MDR is mediated by ABCC1 in hepatocellular carcinoma cell line HepG2 and suggested that miR-326 may be efficient agents for preventing and reversing ADM resistance in cancer cells.

  Unclear Phenotype

         21 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

let-7b directly targets ABCC1 [ 7 ]

Epigenetic Type

microRNA Experiment Method Proteomics

miRNA Stemloop ID

let-7b miRNA Mature ID let-7b-5p

miRNA Sequence

UGAGGUAGUAGGUUGUGUGGUU

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon2

miR-1 directly targets ABCC1 [ 8 ]

Epigenetic Type

microRNA Experiment Method Proteomics;Microarray

miRNA Stemloop ID

miR-1 miRNA Mature ID miR-1-3p

miRNA Sequence

UGGAAUGUAAAGAAGUAUGUAU

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon3

miR-125b directly targets ABCC1 [ 9 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-125b miRNA Mature ID miR-125b-5p

miRNA Sequence

UCCCUGAGACCCUAACUUGUGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon4

miR-1323 directly targets ABCC1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1323 miRNA Mature ID miR-1323

miRNA Sequence

UCAAAACUGAGGGGCAUUUUCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-16 directly targets ABCC1 [ 9 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-16 miRNA Mature ID miR-16-5p

miRNA Sequence

UAGCAGCACGUAAAUAUUGGCG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon6

miR-1825 directly targets ABCC1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1825 miRNA Mature ID miR-1825

miRNA Sequence

UCCAGUGCCCUCCUCUCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-199a directly targets ABCC1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-199a miRNA Mature ID miR-199a-5p

miRNA Sequence

CCCAGUGUUCAGACUACCUGUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-199b directly targets ABCC1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-199b miRNA Mature ID miR-199b-5p

miRNA Sequence

CCCAGUGUUUAGACUAUCUGUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon9

miR-224 directly targets ABCC1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-224 miRNA Mature ID miR-224-5p

miRNA Sequence

UCAAGUCACUAGUGGUUCCGUUUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-23b directly targets ABCC1 [ 9 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-23b miRNA Mature ID miR-23b-3p

miRNA Sequence

AUCACAUUGCCAGGGAUUACCAC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon11

miR-3180 directly targets ABCC1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3180 miRNA Mature ID miR-3180-5p

miRNA Sequence

CUUCCAGACGCUCCGCCCCACGUCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon12

miR-339 directly targets ABCC1 [ 9 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-339 miRNA Mature ID miR-339-5p

miRNA Sequence

UCCCUGUCCUCCAGGAGCUCACG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon13

miR-361 directly targets ABCC1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-361 miRNA Mature ID miR-361-3p

miRNA Sequence

UCCCCCAGGUGUGAUUCUGAUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon14

miR-5195 directly targets ABCC1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5195 miRNA Mature ID miR-5195-3p

miRNA Sequence

AUCCAGUUCUCUGAGGGGGCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon15

miR-520d directly targets ABCC1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-520d miRNA Mature ID miR-520d-5p

miRNA Sequence

CUACAAAGGGAAGCCCUUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon16

miR-524 directly targets ABCC1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-524 miRNA Mature ID miR-524-5p

miRNA Sequence

CUACAAAGGGAAGCACUUUCUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon17

miR-548o directly targets ABCC1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-548o miRNA Mature ID miR-548o-3p

miRNA Sequence

CCAAAACUGCAGUUACUUUUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon18

miR-5582 directly targets ABCC1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5582 miRNA Mature ID miR-5582-3p

miRNA Sequence

UAAAACUUUAAGUGUGCCUAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon19

miR-615 directly targets ABCC1 [ 9 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-615 miRNA Mature ID miR-615-3p

miRNA Sequence

UCCGAGCCUGGGUCUCCCUCUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon20

miR-7-5p directly targets ABCC1 [ 4 ]

Epigenetic Type

microRNA Experiment Method Immunohistochemistry//Luciferase reporter assay//qRT-PCR

miRNA Stemloop ID

miR-7-5p miRNA Mature ID miR-7-5p

miRNA Sequence

UGGAAGACUAGUGAUUUUGUUGUU

miRNA Target Type

Direct

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon21

miR-98 directly targets ABCC1 [ 11 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-98 miRNA Mature ID miR-98-5p

miRNA Sequence

UGAGGUAGUAAGUUGUAUUGUU

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)
References
1 Increased Expression of Plasma-Induced ABCC1 mRNA in Cystic Fibrosis. Int J Mol Sci. 2017 Aug 11;18(8). pii: E1752.
2 Expression and promoter methylation analysis of ATP-binding cassette genes in pancreatic cancer. Oncol Rep. 2012 Jan;27(1):265-9.
3 MicroRNA-134 modulates resistance to doxorubicin in human breast cancer cells by downregulating ABCC1. Biotechnol Lett. 2015 Dec;37(12):2387-94.
4 miR-7 modulates chemoresistance of small cell lung cancer by repressing MRP1/ABCC1. Int J Exp Pathol. 2015 Aug;96(4):240-7.
5 Characterization of SN38-resistant T47D breast cancer cell sublines overexpressing BCRP, MRP1, MRP2, MRP3, and MRP4. BMC Cancer. 2022 Apr 23;22(1):446.
6 Involvement of miR-133a and miR-326 in ADM resistance of HepG2 through modulating expression of ABCC1. J Drug Target. 2015;23(6):519-24.
7 Widespread changes in protein synthesis induced by microRNAs. Nature. 2008 Sep 4;455(7209):58-63.
8 The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.
9 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
10 Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
11 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.