Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0001 Transporter Info | ||||
| Gene Name | ABCC1 | ||||
| Transporter Name | Multidrug resistance-associated protein 1 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Histone acetylation |
|||||
|
Breast cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Hypoacetylation of ABCC1 in Breast cancer | [ 5 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Histone acetylation | Experiment Method | . | ||
|
Related Molecular Changes | Up regulation ofABCC1 | Experiment Method | RT-qPCR and Western blot | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60] | ||||
|
Experimental Material |
T47D/SN120 and T47D/SN150 breast cancer sublines | ||||
|
Additional Notes |
MRP1 overexpression in SN38-resistant T47D cells associated with the suppression of epigenetic gene silencing via DNA hypermethylation and histone deacetylation. | ||||
|
Methylation |
|||||
|
Cystic fibrosis |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Hypomethylation of ABCC1 in cystic fibrosis | [ 1 ] | |||
|
Location |
Promoter (-612 to -317 bp) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Methylation-specific PCR | ||
|
Related Molecular Changes | Up regulation ofABCC1 | Experiment Method | RT-qPCR | ||
|
Studied Phenotype |
Cystic fibrosis[ ICD-11:CA25] | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Additional Notes |
Histone modifications rather than DNA methylation may play a role in regulating ABCC1 expression. | ||||
|
Pancreatic cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Hypomethylation of ABCC1 in pancreatic cancer | [ 2 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Bisulfite sequencing | ||
|
Related Molecular Changes | Up regulation ofABCC1 | Experiment Method | RT-qPCR | ||
|
Studied Phenotype |
Pancreatic cancer[ ICD-11:2C10] | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Additional Notes |
The expression of ABCC1 in human pancreatic cancer cells was not correlated with promoter demethylation. | ||||
|
Breast cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Hypomethylation of ABCC1 in Breast cancer | [ 5 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Methylation | Experiment Method | . | ||
|
Related Molecular Changes | Up regulation ofABCC1 | Experiment Method | RT-qPCR and Western blot | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60] | ||||
|
Experimental Material |
T47D/SN120 and T47D/SN150 breast cancer sublines | ||||
|
Additional Notes |
MRP1 overexpression in SN38-resistant T47D cells associated with the suppression of epigenetic gene silencing via DNA hypermethylation and histone deacetylation. | ||||
|
microRNA |
|||||
|
Breast cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Higher expression of miR-134 in breast cancer (compare to doxorubicin-resistance counterpart cells) | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | . | ||
|
Related Molecular Changes | Down regulation ofABCC1 | Experiment Method | RT-qPCR | ||
|
miRNA Stemloop ID |
miR-134 | miRNA Mature ID | miR-134-3p | ||
|
miRNA Sequence |
CCUGUGGGCCACCUAGUCACCAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Human breast adenocarcinoma cell line (MCF-7) | ||||
|
Additional Notes |
MicroRNA-134 modulates resistance to doxorubicin in breast cancer cells by downregulating the expression of ABCC1. | ||||
|
Small cell lung cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Higher expression of miR-7 in small cell lung cancer (compare with drug-resistant counterpart cells) | [ 4 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Luciferase reporter assay | ||
|
Related Molecular Changes | Down regulation ofABCC1 | Experiment Method | RT-qPCR | ||
|
miRNA Stemloop ID |
miR-7 | miRNA Mature ID | miR-7-5p | ||
|
miRNA Sequence |
UGGAAGACUAGUGAUUUUGUUGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Studied Phenotype |
Small cell lung cancer[ ICD-11:2C25.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Additional Notes |
miR-7 modulates chemoresistance of small cell lung cancer by repressing MRP1/ABCC1. | ||||
|
Hepatocellular carcinoma |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-133a regulates ABCA1 expression | [ 6 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Luciferase reporter assay | ||
|
Related Molecular Changes | Down regulation ofABCC1 | Experiment Method | RT-qPCR | ||
|
miRNA Stemloop ID |
miR-133a | miRNA Mature ID | miR-133a-5p | ||
|
miRNA Sequence |
AGCUGGUAAAAUGGAACCAAAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Human hepatocellular carcinoma cell line (HepG2) | ||||
|
Additional Notes |
The involvement of miR-133a in MDR is mediated by ABCC1 in hepatocellular carcinoma cell line HepG2 and suggested that miR-133a may be efficient agents for preventing and reversing ADM resistance in cancer cells. | ||||
|
Epigenetic Phenomenon2 |
miR-133a regulates ABCA1 expression | [ 6 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Luciferase reporter assay | ||
|
Related Molecular Changes | Down regulation ofABCC1 | Experiment Method | Western Blot | ||
|
miRNA Stemloop ID |
miR-133a | miRNA Mature ID | miR-133a-5p | ||
|
miRNA Sequence |
AGCUGGUAAAAUGGAACCAAAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Human hepatocellular carcinoma cell line (HepG2) | ||||
|
Additional Notes |
The involvement of miR-133a in MDR is mediated by ABCC1 in hepatocellular carcinoma cell line HepG2 and suggested that miR-133a may be efficient agents for preventing and reversing ADM resistance in cancer cells. | ||||
|
Epigenetic Phenomenon3 |
miR-326 regulates ABCA1 expression | [ 6 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Luciferase reporter assay | ||
|
Related Molecular Changes | Down regulation ofABCC1 | Experiment Method | Western Blot | ||
|
miRNA Stemloop ID |
miR-326 | miRNA Mature ID | miR-326 | ||
|
miRNA Sequence |
CCUCUGGGCCCUUCCUCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Human hepatocellular carcinoma cell line (HepG2) | ||||
|
Additional Notes |
The involvement of miR-326 in MDR is mediated by ABCC1 in hepatocellular carcinoma cell line HepG2 and suggested that miR-326 may be efficient agents for preventing and reversing ADM resistance in cancer cells. | ||||
|
Unclear Phenotype |
21 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
let-7b directly targets ABCC1 | [ 7 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Proteomics | ||
|
miRNA Stemloop ID |
let-7b | miRNA Mature ID | let-7b-5p | ||
|
miRNA Sequence |
UGAGGUAGUAGGUUGUGUGGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
|
Epigenetic Phenomenon2 |
miR-1 directly targets ABCC1 | [ 8 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Proteomics;Microarray | ||
|
miRNA Stemloop ID |
miR-1 | miRNA Mature ID | miR-1-3p | ||
|
miRNA Sequence |
UGGAAUGUAAAGAAGUAUGUAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
|
Epigenetic Phenomenon3 |
miR-125b directly targets ABCC1 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-125b | miRNA Mature ID | miR-125b-5p | ||
|
miRNA Sequence |
UCCCUGAGACCCUAACUUGUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon4 |
miR-1323 directly targets ABCC1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1323 | miRNA Mature ID | miR-1323 | ||
|
miRNA Sequence |
UCAAAACUGAGGGGCAUUUUCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon5 |
miR-16 directly targets ABCC1 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-16 | miRNA Mature ID | miR-16-5p | ||
|
miRNA Sequence |
UAGCAGCACGUAAAUAUUGGCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon6 |
miR-1825 directly targets ABCC1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1825 | miRNA Mature ID | miR-1825 | ||
|
miRNA Sequence |
UCCAGUGCCCUCCUCUCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon7 |
miR-199a directly targets ABCC1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-199a | miRNA Mature ID | miR-199a-5p | ||
|
miRNA Sequence |
CCCAGUGUUCAGACUACCUGUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon8 |
miR-199b directly targets ABCC1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-199b | miRNA Mature ID | miR-199b-5p | ||
|
miRNA Sequence |
CCCAGUGUUUAGACUAUCUGUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon9 |
miR-224 directly targets ABCC1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-224 | miRNA Mature ID | miR-224-5p | ||
|
miRNA Sequence |
UCAAGUCACUAGUGGUUCCGUUUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon10 |
miR-23b directly targets ABCC1 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-23b | miRNA Mature ID | miR-23b-3p | ||
|
miRNA Sequence |
AUCACAUUGCCAGGGAUUACCAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon11 |
miR-3180 directly targets ABCC1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3180 | miRNA Mature ID | miR-3180-5p | ||
|
miRNA Sequence |
CUUCCAGACGCUCCGCCCCACGUCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon12 |
miR-339 directly targets ABCC1 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-339 | miRNA Mature ID | miR-339-5p | ||
|
miRNA Sequence |
UCCCUGUCCUCCAGGAGCUCACG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon13 |
miR-361 directly targets ABCC1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-361 | miRNA Mature ID | miR-361-3p | ||
|
miRNA Sequence |
UCCCCCAGGUGUGAUUCUGAUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon14 |
miR-5195 directly targets ABCC1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5195 | miRNA Mature ID | miR-5195-3p | ||
|
miRNA Sequence |
AUCCAGUUCUCUGAGGGGGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon15 |
miR-520d directly targets ABCC1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-520d | miRNA Mature ID | miR-520d-5p | ||
|
miRNA Sequence |
CUACAAAGGGAAGCCCUUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon16 |
miR-524 directly targets ABCC1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-524 | miRNA Mature ID | miR-524-5p | ||
|
miRNA Sequence |
CUACAAAGGGAAGCACUUUCUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon17 |
miR-548o directly targets ABCC1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-548o | miRNA Mature ID | miR-548o-3p | ||
|
miRNA Sequence |
CCAAAACUGCAGUUACUUUUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon18 |
miR-5582 directly targets ABCC1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5582 | miRNA Mature ID | miR-5582-3p | ||
|
miRNA Sequence |
UAAAACUUUAAGUGUGCCUAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon19 |
miR-615 directly targets ABCC1 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-615 | miRNA Mature ID | miR-615-3p | ||
|
miRNA Sequence |
UCCGAGCCUGGGUCUCCCUCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon20 |
miR-7-5p directly targets ABCC1 | [ 4 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Immunohistochemistry//Luciferase reporter assay//qRT-PCR | ||
|
miRNA Stemloop ID |
miR-7-5p | miRNA Mature ID | miR-7-5p | ||
|
miRNA Sequence |
UGGAAGACUAGUGAUUUUGUUGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
miR-98 directly targets ABCC1 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-98 | miRNA Mature ID | miR-98-5p | ||
|
miRNA Sequence |
UGAGGUAGUAAGUUGUAUUGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.