Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0071 Transporter Info | ||||
Gene Name | ABCG1 | ||||
Transporter Name | ATP-binding cassette sub-family G member 1 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
microRNA |
|||||
Ischemic stroke |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Higher expression of miR-23a-5p in acute ischemic stroke | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Luciferase reporter assay | ||
Related Molecular Changes | Down regulation ofABCG1 | Experiment Method | RT-qPCR | ||
miRNA Stemloop ID |
miR-23a | miRNA Mature ID | miR-23a-5p | ||
miRNA Sequence |
GGGGUUCCUGGGGAUGGGAUUU | ||||
miRNA Target Type |
Direct | ||||
Studied Phenotype |
Ischemic stroke[ ICD-11:8B11] | ||||
Experimental Material |
Patient tissue samples | ||||
Additional Notes |
miR-23a-5p regulates cholesterol efflux in ABCG1-dependent pathway and miR-23a-5p might be a potential therapeutic target for suppressing atherosclerosis. | ||||
Gastric cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
miR-129-5p downregulates of ABCG1 in gastric cancer | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Luciferase reporter assay | ||
Related Molecular Changes | Down regulation ofABCG1 | Experiment Method | Western Blot | ||
miRNA Stemloop ID |
miR-129 | miRNA Mature ID | miR-129-5p | ||
miRNA Sequence |
CUUUUUGCGGUCUGGGCUUGC | ||||
miRNA Target Type |
Direct | ||||
Studied Phenotype |
Gastric cancer[ ICD-11:2B72] | ||||
Experimental Material |
Human gastric adenocarcinoma cell line (SGC7901) | ||||
Additional Notes |
miR-129-5p regulates ABCG1 expression in vivo at the post-transcriptional level. | ||||
Unclear Phenotype |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
miR-10b directly targets RALBP1 | [ 6 ] | |||
Epigenetic Type |
microRNA | Experiment Method | miRNA Microarray Analysis | ||
miRNA Stemloop ID |
miR-10b | miRNA Mature ID | miR-10b-5p | ||
miRNA Sequence |
UACCCUGUAGAACCGAAUUUGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon2 |
miR-129 directly targets ABCG1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Immunohistochemistry//Luciferase reporter assay//Microarray//qRT-PCR//Western blot | ||
miRNA Stemloop ID |
miR-129 | miRNA Mature ID | miR-129-5p | ||
miRNA Sequence |
CUUUUUGCGGUCUGGGCUUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human gastric adenocarcinoma cell line (SGC7901) | ||||
Methylation |
|||||
Coronary heart disease |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Hypermethylation of ABCG1 in coronary heart disease | [ 1 ] | |||
Location |
Promoter (cg06500161) | ||||
Epigenetic Type |
Methylation | Experiment Method | HumanMethylation450 BeadChip | ||
Related Molecular Changes | Down regulation ofABCG1 | Experiment Method | RT-qPCR | ||
Studied Phenotype |
Coronary heart disease[ ICD-11:BA80.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Additional Notes |
ABCG1 methylation (cg06500161) was negatively associated with ABCG1 mRNA levels. | ||||
Epigenetic Phenomenon2 |
Hypermethylation of ABCG1 in coronary heart disease | [ 4 ] | |||
Location |
Promoter | ||||
Epigenetic Type |
Methylation | Experiment Method | Methylation-specific PCR | ||
Studied Phenotype |
Coronary heart disease[ ICD-11:BA80.Z] | ||||
Frequency |
52 (61%) out of the 85 studied sample | ||||
Experimental Material |
Patient tissue samples | ||||
Additional Notes |
Promoter DNA Hypermethylation of the ABCG1 is associated with an increased risk of CHD (p<0.001). | ||||
Type 2 diabetes |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Hypermethylation of ABCG1 in type 2 diabetes | [ 5 ] | |||
Location |
Promoter (cg06500161) | ||||
Epigenetic Type |
Methylation | Experiment Method | . | ||
Studied Phenotype |
Type 2 diabetes[ ICD-11:5A11] | ||||
Frequency |
58% of the studied samples | ||||
Experimental Material |
Patient tissue samples | ||||
Additional Notes |
Increase risk for future type 2 diabetes | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.