General Information of Drug Transporter (DT)
DT ID DTD0057 Transporter Info
Gene Name ABCC11
Transporter Name Multidrug resistance-associated protein 8
Gene ID
85320
UniProt ID
Q96J66
Epigenetic Regulations of This DT (EGR)

Histone acetylation

  Acute myeloid leukemia

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Hypoacetylation of ABCB11 in acute myeloid leukemia (compare with valproate treatment counterpart cells) [ 1 ]

Location

Promoter

Epigenetic Type

Histone acetylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

Up regulation ofABCC11 Experiment Method RT-qPCR

Studied Phenotype

Acute myeloid leukemia[ ICD-11:2A60]

Experimental Material

Multiple cell lines of human

Additional Notes

Chromatin immunoprecipitation revealed the hyperacetylation of histone proteins in the promoter regions of MDR1, BCRP, and MRP8 on valproate treatment.

  Epigenetic Phenomenon2

Hypoacetylation of ABCB11 in acute myeloid leukemia (compare with valproate treatment counterpart cells) [ 1 ]

Location

Promoter

Epigenetic Type

Histone acetylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

Up regulation ofABCC11 Experiment Method RT-qPCR

Studied Phenotype

Acute myeloid leukemia[ ICD-11:2A60]

Experimental Material

Multiple cell lines of human

Additional Notes

Chromatin immunoprecipitation revealed the hyperacetylation of histone proteins in the promoter regions of MDR1, BCRP, and MRP8 on valproate treatment.

microRNA

  Unclear Phenotype

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

hsa-miR-1291 directly targets ABCC1 [ 2 ]

Epigenetic Type

microRNA Experiment Method Luciferase reporter assay

Related Molecular Changes

Down regulation ofABCC1 Experiment Method Western Blot

miRNA Stemloop ID

miR-1291 miRNA Mature ID miR-1291

miRNA Target Type

Direct

Experimental Material

Human pancreatic carcinoma cell line (PANC-1)

Additional Notes

Overexpression of hsa-miR-1291 led to a reduced ABCC1 protein expression in hsa-miR-1291 stably transfected cells.

  Epigenetic Phenomenon2

miR-335 directly targets ABCC11 [ 3 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

Methylation

  Prostate cancer metastasis

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of ABCC11 in prostate cancer metastasis than that in healthy individual

Studied Phenotype

Prostate cancer metastasis [ICD-11:2.00E+06]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.000575537; Fold-change:-0.45872133; Z-score:-10.6961536
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Prostate cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of ABCC11 in prostate cancer than that in healthy individual

Studied Phenotype

Prostate cancer [ICD-11:2C82]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.000551072; Fold-change:-0.377007279; Z-score:-2.612870252
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
References
1 Histone deacetylase inhibitors induce a very broad, pleiotropic anticancer drug resistance phenotype in acute myeloid leukemia cells by modulation of multiple ABC transporter genes. Clin Cancer Res. 2009 Jun 1;15(11):3705-15.
2 Small nucleolar RNA-derived microRNA hsa-miR-1291 modulates cellular drug disposition through direct targeting of ABC transporter ABCC1. Drug Metab Dispos. 2013 Oct;41(10):1744-51.
3 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.