Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0055 Transporter Info | ||||
| Gene Name | ABCB9 | ||||
| Transporter Name | TAP-like protein | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Atypical teratoid rhabdoid tumor |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ABCB9 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg16314862) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-5.18E+00 | Statistic Test | p-value:1.75E-06; Z-score:-1.59E+00 | ||
|
Methylation in Case |
6.35E-02 (Median) | Methylation in Control | 3.29E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of ABCB9 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg16427983) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.52E+00 | Statistic Test | p-value:1.81E-06; Z-score:-1.10E+00 | ||
|
Methylation in Case |
9.90E-02 (Median) | Methylation in Control | 2.50E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ABCB9 in breast cancer | [ 2 ] | |||
|
Location |
5'UTR (cg16427983) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:3.06E-07; Z-score:1.04E+00 | ||
|
Methylation in Case |
7.66E-01 (Median) | Methylation in Control | 7.16E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ABCB9 in colorectal cancer | [ 3 ] | |||
|
Location |
5'UTR (cg16427983) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:3.43E-02; Z-score:6.65E-01 | ||
|
Methylation in Case |
8.86E-01 (Median) | Methylation in Control | 8.44E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ABCB9 in hepatocellular carcinoma | [ 4 ] | |||
|
Location |
5'UTR (cg16427983) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.16E-05; Z-score:-6.93E-01 | ||
|
Methylation in Case |
8.21E-01 (Median) | Methylation in Control | 8.40E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
HIV infection |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ABCB9 in HIV infection | [ 5 ] | |||
|
Location |
5'UTR (cg16314862) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.00E+00 | Statistic Test | p-value:3.69E-02; Z-score:2.53E-01 | ||
|
Methylation in Case |
9.50E-01 (Median) | Methylation in Control | 9.46E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ABCB9 in pancretic ductal adenocarcinoma | [ 6 ] | |||
|
Location |
5'UTR (cg13323097) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.34E+00 | Statistic Test | p-value:1.11E-17; Z-score:-2.90E+00 | ||
|
Methylation in Case |
1.97E-01 (Median) | Methylation in Control | 2.64E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Parkinson's disease |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Hypomethylation of ABCB9 in parkinson's disease | [ 7 ] | |||
|
Location |
Body (cg04772575) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | HumanMethylation450 BeadChip | ||
|
Studied Phenotype |
Parkinson's disease[ ICD-11:8A00.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Additional Notes |
Hypomethylation in parkison's disease cases can be observed for a highly significant CpGs in immune-related genes cg04772575 in ABCB9 (p =?4.3??1010). | ||||
|
microRNA |
|||||
|
Breast cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Higher expression of miR-24 in breast cancer (compare with paclitaxel-resistant counterpart cells) | [ 8 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Luciferase reporter assay | ||
|
Related Molecular Changes | Down regulation ofABCB9 | Experiment Method | Western Blot | ||
|
miRNA Stemloop ID |
miR-24 | miRNA Mature ID | miR-24-3p | ||
|
miRNA Sequence |
UGGCUCAGUUCAGCAGGAACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Human breast adenocarcinoma cell line (MCF-7); Patient tissue samples | ||||
|
Additional Notes |
miR-24 overexpression may increase the sensitivity of breast cancer cells to paclitaxel by targeting ABCB9. | ||||
|
Non-small cell lung cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Lower expression of miR-31 in non-small cell lung cancer (compare with cisplatin-resistant cells) | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Luciferase reporter assay | ||
|
Related Molecular Changes | Down regulation ofABCB9 | Experiment Method | RT-qPCR | ||
|
miRNA Stemloop ID |
miR-31 | miRNA Mature ID | miR-31-5p | ||
|
miRNA Sequence |
AGGCAAGAUGCUGGCAUAGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Studied Phenotype |
Non-small cell lung cancer[ ICD-11:2C25.4] | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Additional Notes |
miR-31 overexpression may induced the resistance of non-small cell lung cancer cells to paclitaxel by targeting ABCB9. | ||||
|
Unclear Phenotype |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-24 directly targets ABCB9 | [ 8 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Luciferase reporter assay//qRT-PCR//Western blot | ||
|
miRNA Stemloop ID |
miR-24 | miRNA Mature ID | miR-24-3p | ||
|
miRNA Sequence |
UGGCUCAGUUCAGCAGGAACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human breast adenocarcinoma cell line (MCF-7); Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
miR-26a directly targets ABCB9 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-26a | miRNA Mature ID | miR-26a-5p | ||
|
miRNA Sequence |
UUCAAGUAAUCCAGGAUAGGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon3 |
miR-31 directly targets ABCB9 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Luciferase reporter assay//qRT-PCR//Western blot | ||
|
miRNA Stemloop ID |
miR-31 | miRNA Mature ID | miR-31-5p | ||
|
miRNA Sequence |
AGGCAAGAUGCUGGCAUAGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon4 |
miR-335 directly targets ABCB9 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-335 | miRNA Mature ID | miR-335-5p | ||
|
miRNA Sequence |
UCAAGAGCAAUAACGAAAAAUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.