Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0044 Transporter Info | ||||
| Gene Name | ABCA6 | ||||
| Transporter Name | ATP-binding cassette sub-family A member 6 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Breast cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ABCA6 in breast cancer | [ 1 ] | |||
|
Location |
TSS1500 (cg04380955) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.60E+00 | Statistic Test | p-value:3.38E-14; Z-score:3.08E+00 | ||
|
Methylation in Case |
6.42E-01 (Median) | Methylation in Control | 4.00E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of ABCA6 in breast cancer | [ 1 ] | |||
|
Location |
TSS200 (cg24086348) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:3.86E-02; Z-score:-7.78E-03 | ||
|
Methylation in Case |
2.56E-01 (Median) | Methylation in Control | 2.56E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ABCA6 in colorectal cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg04380955) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:4.02E-02; Z-score:-5.70E-01 | ||
|
Methylation in Case |
8.29E-01 (Median) | Methylation in Control | 8.65E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ABCA6 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg04380955) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.37E+00 | Statistic Test | p-value:2.81E-08; Z-score:-1.65E+00 | ||
|
Methylation in Case |
3.43E-01 (Median) | Methylation in Control | 4.69E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of ABCA6 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg24086348) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.21E+00 | Statistic Test | p-value:4.91E-03; Z-score:-4.72E-01 | ||
|
Methylation in Case |
2.94E-01 (Median) | Methylation in Control | 3.56E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ABCA6 in pancretic ductal adenocarcinoma | [ 4 ] | |||
|
Location |
Body (cg00645664) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:1.70E-02; Z-score:1.03E+00 | ||
|
Methylation in Case |
8.95E-01 (Median) | Methylation in Control | 8.53E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Prostate cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ABCA6 in prostate cancer | [ 5 ] | |||
|
Location |
Body (cg19178081) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:9.81E-03; Z-score:2.21E+00 | ||
|
Methylation in Case |
8.90E-01 (Median) | Methylation in Control | 8.14E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Squamous cell carcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Moderate/moderate hypermethylation of ABCA6 in squamous cell carcinoma than that in healthy individual/adjacent tissue | ||||
Studied Phenotype |
Squamous cell carcinoma [ICD-11:2B60] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.000392247; Fold-change:0.237583412; Z-score:2.011844206 | ||||
The Methylation Level of Disease Section Compare with the Adjacent Tissue |
p-value:0.019053425; Fold-change:0.206031349; Z-score:1.464972076 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Ovarian cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Moderate hypermethylation of ABCA6 in ovarian cancer than that in healthy individual | ||||
Studied Phenotype |
Ovarian cancer [ICD-11:2C73] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.011869053; Fold-change:0.242554497; Z-score:1.100486753 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Posterior fossa ependymoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Moderate hypermethylation of ABCA6 in posterior fossa ependymoma than that in healthy individual | ||||
Studied Phenotype |
Posterior fossa ependymoma [ICD-11:2D50.2] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:6.94E-27; Fold-change:0.245218955; Z-score:1.064706833 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Spinal ependymoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Moderate hypermethylation of ABCA6 in spinal ependymoma than that in healthy individual | ||||
Studied Phenotype |
Spinal ependymoma [ICD-11:2A00.0Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.041445584; Fold-change:0.257089987; Z-score:0.881344502 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Acute myeloid leukemia |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Moderate hypomethylation of ABCA6 in acute myeloid leukemia than that in healthy individual | ||||
Studied Phenotype |
Acute myeloid leukemia [ICD-11:2A60] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:3.14E-08; Fold-change:-0.251070701; Z-score:-1.590155378 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Anaplastic pleomorphic xanthoastrocytoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Moderate hypomethylation of ABCA6 in anaplastic pleomorphic xanthoastrocytoma than that in healthy individual | ||||
Studied Phenotype |
Anaplastic pleomorphic xanthoastrocytoma [ICD-11:2A00.0Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:6.58E-05; Fold-change:-0.276731492; Z-score:-0.887363601 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Malignant astrocytoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Moderate hypomethylation of ABCA6 in malignant astrocytoma than that in healthy individual | ||||
Studied Phenotype |
Malignant astrocytoma [ICD-11:2A00.12] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:1.03E-12; Fold-change:-0.222290794; Z-score:-1.043365453 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Osteoarthritis |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Moderate hypomethylation of ABCA6 in osteoarthritis than that in healthy individual | ||||
Studied Phenotype |
Osteoarthritis [ICD-11:FA00] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:2.41E-11; Fold-change:-0.220230356; Z-score:-2.871122107 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Third ventricle chordoid glioma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Moderate hypomethylation of ABCA6 in third ventricle chordoid glioma than that in healthy individual | ||||
Studied Phenotype |
Third ventricle chordoid glioma [ICD-11:2A00.0Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.01891512; Fold-change:-0.25508487; Z-score:-0.766414935 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Atypical teratoid rhabdoid tumour |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Significant hypermethylation of ABCA6 in atypical teratoid rhabdoid tumour than that in healthy individual | ||||
Studied Phenotype |
Atypical teratoid rhabdoid tumour [ICD-11:2A00.1Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:7.44E-13; Fold-change:0.582747724; Z-score:2.038280964 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Cerebellar liponeurocytoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Significant hypermethylation of ABCA6 in cerebellar liponeurocytoma than that in healthy individual | ||||
Studied Phenotype |
Cerebellar liponeurocytoma [ICD-11:2A00.0Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.000746133; Fold-change:0.391760039; Z-score:1.320543311 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Esthesioneuroblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Significant hypermethylation of ABCA6 in esthesioneuroblastoma than that in healthy individual | ||||
Studied Phenotype |
Esthesioneuroblastoma [ICD-11:2D50.1] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:1.24E-07; Fold-change:0.536896296; Z-score:1.738902528 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Granulomatous lung disease |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Significant hypermethylation of ABCA6 in granulomatous lung disease than that in healthy individual | ||||
Studied Phenotype |
Granulomatous lung disease [ICD-11:CB05] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:6.94E-05; Fold-change:0.333829715; Z-score:3.15105701 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Medulloblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Significant hypermethylation of ABCA6 in medulloblastoma than that in healthy individual | ||||
Studied Phenotype |
Medulloblastoma [ICD-11:2A00.10] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:6.47E-34; Fold-change:0.39932814; Z-score:1.930973607 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Melanocytoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Significant hypermethylation of ABCA6 in melanocytoma than that in healthy individual | ||||
Studied Phenotype |
Melanocytoma [ICD-11:2F36.2] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:7.86E-07; Fold-change:0.604731546; Z-score:1.898322098 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Multilayered rosettes embryonal tumour |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Significant hypermethylation of ABCA6 in multilayered rosettes embryonal tumour than that in healthy individual | ||||
Studied Phenotype |
Multilayered rosettes embryonal tumour [ICD-11:2A00.1] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:1.06E-06; Fold-change:0.349177423; Z-score:1.231349238 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
RELA YAP fusion ependymoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Significant hypermethylation of ABCA6 in rela yap fusion ependymoma than that in healthy individual | ||||
Studied Phenotype |
RELA YAP fusion ependymoma [ICD-11:2A00.0Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:2.09E-14; Fold-change:0.306156576; Z-score:1.428815419 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Brain neuroblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Significant hypomethylation of ABCA6 in brain neuroblastoma than that in healthy individual | ||||
Studied Phenotype |
Brain neuroblastoma [ICD-11:2A00.11] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:2.05E-09; Fold-change:-0.359411368; Z-score:-1.27354928 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Diffuse midline glioma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Significant hypomethylation of ABCA6 in diffuse midline glioma than that in healthy individual | ||||
Studied Phenotype |
Diffuse midline glioma [ICD-11:2A00.0Z] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:4.80E-23; Fold-change:-0.30670521; Z-score:-1.308630393 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Obesity |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Significant hypomethylation of ABCA6 in obesity than that in healthy individual | ||||
Studied Phenotype |
Obesity [ICD-11:5B81] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:5.32E-35; Fold-change:-0.771655459; Z-score:-3.716701061 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Vestibular melanotic schwannoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Significant hypomethylation of ABCA6 in vestibular melanotic schwannoma than that in healthy individual | ||||
Studied Phenotype |
Vestibular melanotic schwannoma [ICD-11:2A02.3] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.016465048; Fold-change:-0.333242233; Z-score:-2.047528 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Gastric cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Significant hypermethylation of ABCA6 in gastric cancer than that in adjacent tissue | ||||
Studied Phenotype |
Gastric cancer [ICD-11:2B72] | ||||
The Methylation Level of Disease Section Compare with the Adjacent Tissue |
p-value:0.013533681; Fold-change:0.377659729; Z-score:4.912580989 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Lung cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Significant hypomethylation of ABCA6 in lung cancer than that in adjacent tissue | ||||
Studied Phenotype |
Lung cancer [ICD-11:2C25] | ||||
The Methylation Level of Disease Section Compare with the Adjacent Tissue |
p-value:9.95E-08; Fold-change:-0.324122604; Z-score:-4.754847995 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients
|
|||||
|
microRNA |
|||||
|
Unclear Phenotype |
27 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-122 directly targets ABCA6 | [ 6 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-122 | miRNA Mature ID | miR-122-5p | ||
|
miRNA Sequence |
UGGAGUGUGACAAUGGUGUUUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon2 |
miR-1279 directly targets ABCA6 | [ 7 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1279 | miRNA Mature ID | miR-1279 | ||
|
miRNA Sequence |
UCAUAUUGCUUCUUUCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon3 |
miR-197 directly targets ABCA6 | [ 7 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-197 | miRNA Mature ID | miR-197-3p | ||
|
miRNA Sequence |
UUCACCACCUUCUCCACCCAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon4 |
miR-215 directly targets ABCA6 | [ 6 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-215 | miRNA Mature ID | miR-215-3p | ||
|
miRNA Sequence |
UCUGUCAUUUCUUUAGGCCAAUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon5 |
miR-26b directly targets ABCA6 | [ 8 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-26b | miRNA Mature ID | miR-26b-5p | ||
|
miRNA Sequence |
UUCAAGUAAUUCAGGAUAGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
|
Epigenetic Phenomenon6 |
miR-3135b directly targets ABCA6 | [ 6 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3135b | miRNA Mature ID | miR-3135b | ||
|
miRNA Sequence |
GGCUGGAGCGAGUGCAGUGGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon7 |
miR-3157 directly targets ABCA6 | [ 7 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3157 | miRNA Mature ID | miR-3157-5p | ||
|
miRNA Sequence |
UUCAGCCAGGCUAGUGCAGUCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon8 |
miR-3187 directly targets ABCA6 | [ 7 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3187 | miRNA Mature ID | miR-3187-3p | ||
|
miRNA Sequence |
UUGGCCAUGGGGCUGCGCGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon9 |
miR-3652 directly targets ABCA6 | [ 6 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3652 | miRNA Mature ID | miR-3652 | ||
|
miRNA Sequence |
CGGCUGGAGGUGUGAGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon10 |
miR-3664 directly targets ABCA6 | [ 6 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3664 | miRNA Mature ID | miR-3664-5p | ||
|
miRNA Sequence |
AACUCUGUCUUCACUCAUGAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon11 |
miR-4430 directly targets ABCA6 | [ 6 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4430 | miRNA Mature ID | miR-4430 | ||
|
miRNA Sequence |
AGGCUGGAGUGAGCGGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon12 |
miR-4435 directly targets ABCA6 | [ 7 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4435 | miRNA Mature ID | miR-4435 | ||
|
miRNA Sequence |
AUGGCCAGAGCUCACACAGAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon13 |
miR-4534 directly targets ABCA6 | [ 7 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4534 | miRNA Mature ID | miR-4534 | ||
|
miRNA Sequence |
GGAUGGAGGAGGGGUCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon14 |
miR-4653 directly targets ABCA6 | [ 7 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4653 | miRNA Mature ID | miR-4653-3p | ||
|
miRNA Sequence |
UGGAGUUAAGGGUUGCUUGGAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon15 |
miR-4701 directly targets ABCA6 | [ 7 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4701 | miRNA Mature ID | miR-4701-5p | ||
|
miRNA Sequence |
UUGGCCACCACACCUACCCCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon16 |
miR-4717 directly targets ABCA6 | [ 6 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4717 | miRNA Mature ID | miR-4717-3p | ||
|
miRNA Sequence |
ACACAUGGGUGGCUGUGGCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon17 |
miR-500b directly targets ABCA6 | [ 6 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-500b | miRNA Mature ID | miR-500b-3p | ||
|
miRNA Sequence |
GCACCCAGGCAAGGAUUCUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon18 |
miR-504 directly targets ABCA6 | [ 6 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-504 | miRNA Mature ID | miR-504-3p | ||
|
miRNA Sequence |
GGGAGUGCAGGGCAGGGUUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon19 |
miR-548s directly targets ABCA6 | [ 7 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548s | miRNA Mature ID | miR-548s | ||
|
miRNA Sequence |
AUGGCCAAAACUGCAGUUAUUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon20 |
miR-5589 directly targets ABCA6 | [ 6 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5589 | miRNA Mature ID | miR-5589-3p | ||
|
miRNA Sequence |
UGCACAUGGCAACCUAGCUCCCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon21 |
miR-585 directly targets ABCA6 | [ 6 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-585 | miRNA Mature ID | miR-585-5p | ||
|
miRNA Sequence |
CUAGCACACAGAUACGCCCAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon22 |
miR-588 directly targets ABCA6 | [ 7 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-588 | miRNA Mature ID | miR-588 | ||
|
miRNA Sequence |
UUGGCCACAAUGGGUUAGAAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon23 |
miR-6514 directly targets ABCA6 | [ 7 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6514 | miRNA Mature ID | miR-6514-5p | ||
|
miRNA Sequence |
UAUGGAGUGGACUUUCAGCUGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon24 |
miR-6773 directly targets ABCA6 | [ 6 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6773 | miRNA Mature ID | miR-6773-3p | ||
|
miRNA Sequence |
ACUGUCACUUCUCUGCCCAUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon25 |
miR-6879 directly targets ABCA6 | [ 6 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6879 | miRNA Mature ID | miR-6879-3p | ||
|
miRNA Sequence |
UGUCACCCGCUCCUUGCCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon26 |
miR-8082 directly targets ABCA6 | [ 7 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-8082 | miRNA Mature ID | miR-8082 | ||
|
miRNA Sequence |
UGAUGGAGCUGGGAAUACUCUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon27 |
miR-96 directly targets ABCA6 | [ 6 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-96 | miRNA Mature ID | miR-96-5p | ||
|
miRNA Sequence |
UUUGGCACUAGCACAUUUUUGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples