General Information of Drug Transporter (DT)
DT ID DTD0042 Transporter Info
Gene Name ABCA4
Transporter Name ATP-binding cassette sub-family A member 4
Gene ID
24
UniProt ID
P78363
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

         16 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCA4 in bladder cancer [ 1 ]

Location

TSS1500 (cg09360041)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.24E+00 Statistic Test p-value:5.09E-13; Z-score:-1.69E+01

Methylation in Case

3.57E-01 (Median) Methylation in Control 8.00E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of ABCA4 in bladder cancer [ 1 ]

Location

TSS1500 (cg12869058)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.88E+00 Statistic Test p-value:9.95E-10; Z-score:-2.57E+01

Methylation in Case

4.30E-01 (Median) Methylation in Control 8.07E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of ABCA4 in bladder cancer [ 1 ]

Location

TSS1500 (cg06895831)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.70E+00 Statistic Test p-value:1.71E-09; Z-score:-1.02E+01

Methylation in Case

4.45E-01 (Median) Methylation in Control 7.56E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of ABCA4 in bladder cancer [ 1 ]

Location

TSS1500 (cg16298016)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.12E+00 Statistic Test p-value:3.05E-04; Z-score:-3.83E+00

Methylation in Case

7.66E-01 (Median) Methylation in Control 8.62E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of ABCA4 in bladder cancer [ 1 ]

Location

Body (cg14014879)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.78E+00 Statistic Test p-value:4.15E-13; Z-score:1.41E+01

Methylation in Case

6.96E-01 (Median) Methylation in Control 3.92E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of ABCA4 in bladder cancer [ 1 ]

Location

Body (cg01922613)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.83E+00 Statistic Test p-value:3.39E-12; Z-score:1.17E+01

Methylation in Case

7.85E-01 (Median) Methylation in Control 4.30E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of ABCA4 in bladder cancer [ 1 ]

Location

Body (cg18185648)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.88E+00 Statistic Test p-value:2.14E-07; Z-score:5.90E+00

Methylation in Case

6.09E-01 (Median) Methylation in Control 3.25E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of ABCA4 in bladder cancer [ 1 ]

Location

Body (cg04491808)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.29E+00 Statistic Test p-value:5.55E-07; Z-score:-4.29E+00

Methylation in Case

5.33E-01 (Median) Methylation in Control 6.91E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of ABCA4 in bladder cancer [ 1 ]

Location

Body (cg12600556)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:9.51E-07; Z-score:-7.30E+00

Methylation in Case

6.95E-01 (Median) Methylation in Control 8.13E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of ABCA4 in bladder cancer [ 1 ]

Location

Body (cg01807748)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.19E+00 Statistic Test p-value:4.34E-06; Z-score:-6.05E+00

Methylation in Case

1.78E-01 (Median) Methylation in Control 3.90E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of ABCA4 in bladder cancer [ 1 ]

Location

Body (cg18800235)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.28E+00 Statistic Test p-value:1.67E-05; Z-score:-8.56E+00

Methylation in Case

6.52E-01 (Median) Methylation in Control 8.34E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of ABCA4 in bladder cancer [ 1 ]

Location

Body (cg01921066)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.98E+00 Statistic Test p-value:1.82E-04; Z-score:-3.83E+00

Methylation in Case

1.20E-01 (Median) Methylation in Control 2.38E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of ABCA4 in bladder cancer [ 1 ]

Location

Body (cg09168805)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.70E+00 Statistic Test p-value:2.23E-04; Z-score:-3.40E+00

Methylation in Case

3.19E-01 (Median) Methylation in Control 5.42E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of ABCA4 in bladder cancer [ 1 ]

Location

Body (cg09234454)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.58E+00 Statistic Test p-value:1.11E-02; Z-score:2.60E+00

Methylation in Case

9.14E-01 (Median) Methylation in Control 5.79E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of ABCA4 in bladder cancer [ 1 ]

Location

Body (cg09326529)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.78E-02; Z-score:-4.67E+00

Methylation in Case

9.58E-01 (Median) Methylation in Control 9.70E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of ABCA4 in bladder cancer [ 1 ]

Location

3'UTR (cg18377941)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:7.00E-05; Z-score:-6.35E+00

Methylation in Case

8.06E-01 (Median) Methylation in Control 9.08E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

         18 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCA4 in breast cancer [ 2 ]

Location

TSS1500 (cg09360041)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:6.43E-13; Z-score:-2.04E+00

Methylation in Case

7.11E-01 (Median) Methylation in Control 8.17E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of ABCA4 in breast cancer [ 2 ]

Location

TSS1500 (cg12869058)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:5.69E-08; Z-score:-1.43E+00

Methylation in Case

7.15E-01 (Median) Methylation in Control 8.19E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of ABCA4 in breast cancer [ 2 ]

Location

TSS1500 (cg06895831)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:2.14E-07; Z-score:-1.45E+00

Methylation in Case

7.93E-01 (Median) Methylation in Control 8.47E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of ABCA4 in breast cancer [ 2 ]

Location

TSS1500 (cg16298016)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:2.13E-02; Z-score:-6.33E-01

Methylation in Case

8.66E-01 (Median) Methylation in Control 8.98E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of ABCA4 in breast cancer [ 2 ]

Location

1stExon (cg04592706)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:5.04E-08; Z-score:-1.14E+00

Methylation in Case

8.88E-01 (Median) Methylation in Control 9.16E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of ABCA4 in breast cancer [ 2 ]

Location

Body (cg04491808)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.24E+00 Statistic Test p-value:3.59E-17; Z-score:-3.25E+00

Methylation in Case

6.22E-01 (Median) Methylation in Control 7.74E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of ABCA4 in breast cancer [ 2 ]

Location

Body (cg18185648)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.56E+00 Statistic Test p-value:1.89E-13; Z-score:3.09E+00

Methylation in Case

4.44E-01 (Median) Methylation in Control 2.85E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of ABCA4 in breast cancer [ 2 ]

Location

Body (cg19378389)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:4.52E-10; Z-score:-1.75E+00

Methylation in Case

7.63E-01 (Median) Methylation in Control 8.44E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of ABCA4 in breast cancer [ 2 ]

Location

Body (cg04100956)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:4.37E-09; Z-score:-1.69E+00

Methylation in Case

5.80E-01 (Median) Methylation in Control 6.91E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of ABCA4 in breast cancer [ 2 ]

Location

Body (cg14014879)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.22E+00 Statistic Test p-value:9.33E-08; Z-score:1.99E+00

Methylation in Case

5.19E-01 (Median) Methylation in Control 4.25E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of ABCA4 in breast cancer [ 2 ]

Location

Body (cg26904308)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:1.41E-06; Z-score:1.34E+00

Methylation in Case

7.61E-01 (Median) Methylation in Control 6.55E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of ABCA4 in breast cancer [ 2 ]

Location

Body (cg01922613)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.26E+00 Statistic Test p-value:3.98E-06; Z-score:1.19E+00

Methylation in Case

5.31E-01 (Median) Methylation in Control 4.22E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of ABCA4 in breast cancer [ 2 ]

Location

Body (cg09168805)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:4.98E-06; Z-score:8.08E-01

Methylation in Case

6.85E-01 (Median) Methylation in Control 6.31E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of ABCA4 in breast cancer [ 2 ]

Location

Body (cg12600556)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:4.24E-03; Z-score:-4.40E-01

Methylation in Case

7.66E-01 (Median) Methylation in Control 7.82E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of ABCA4 in breast cancer [ 2 ]

Location

Body (cg09234454)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.20E+00 Statistic Test p-value:4.65E-03; Z-score:6.08E-01

Methylation in Case

7.66E-01 (Median) Methylation in Control 6.36E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of ABCA4 in breast cancer [ 2 ]

Location

Body (cg01807748)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:8.76E-03; Z-score:-9.02E-01

Methylation in Case

5.68E-01 (Median) Methylation in Control 6.17E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of ABCA4 in breast cancer [ 2 ]

Location

Body (cg12085314)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:1.34E-02; Z-score:2.59E-01

Methylation in Case

6.15E-02 (Median) Methylation in Control 5.31E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon18

Methylation of ABCA4 in breast cancer [ 2 ]

Location

3'UTR (cg18377941)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.63E-07; Z-score:-9.70E-01

Methylation in Case

8.72E-01 (Median) Methylation in Control 9.02E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Colorectal cancer

         11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCA4 in colorectal cancer [ 3 ]

Location

TSS1500 (cg16298016)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:1.15E-10; Z-score:-4.67E+00

Methylation in Case

7.93E-01 (Median) Methylation in Control 9.05E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of ABCA4 in colorectal cancer [ 3 ]

Location

TSS1500 (cg09360041)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.12E+00 Statistic Test p-value:4.51E-06; Z-score:-1.36E+00

Methylation in Case

7.84E-01 (Median) Methylation in Control 8.79E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of ABCA4 in colorectal cancer [ 3 ]

Location

TSS1500 (cg06895831)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.29E+00 Statistic Test p-value:2.14E-04; Z-score:-1.18E+00

Methylation in Case

4.32E-01 (Median) Methylation in Control 5.58E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of ABCA4 in colorectal cancer [ 3 ]

Location

TSS1500 (cg12869058)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:2.12E-02; Z-score:-2.37E-01

Methylation in Case

8.24E-01 (Median) Methylation in Control 8.41E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of ABCA4 in colorectal cancer [ 3 ]

Location

Body (cg04491808)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:1.43E-08; Z-score:-2.05E+00

Methylation in Case

6.87E-01 (Median) Methylation in Control 7.86E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of ABCA4 in colorectal cancer [ 3 ]

Location

Body (cg01437135)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:3.91E-08; Z-score:-1.78E+00

Methylation in Case

7.21E-01 (Median) Methylation in Control 7.99E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of ABCA4 in colorectal cancer [ 3 ]

Location

Body (cg19378389)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:5.32E-06; Z-score:-1.91E+00

Methylation in Case

8.73E-01 (Median) Methylation in Control 9.08E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of ABCA4 in colorectal cancer [ 3 ]

Location

Body (cg04100956)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:2.02E-04; Z-score:-9.90E-01

Methylation in Case

7.67E-01 (Median) Methylation in Control 8.21E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of ABCA4 in colorectal cancer [ 3 ]

Location

Body (cg09168805)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:3.52E-03; Z-score:-3.53E-01

Methylation in Case

7.72E-01 (Median) Methylation in Control 7.96E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of ABCA4 in colorectal cancer [ 3 ]

Location

3'UTR (cg18377941)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.18E+00 Statistic Test p-value:1.31E-05; Z-score:-1.57E+00

Methylation in Case

7.51E-01 (Median) Methylation in Control 8.86E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

         22 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCA4 in hepatocellular carcinoma [ 4 ]

Location

TSS1500 (cg12175729)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:5.46E+00 Statistic Test p-value:3.62E-19; Z-score:5.30E+00

Methylation in Case

4.43E-01 (Median) Methylation in Control 8.12E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of ABCA4 in hepatocellular carcinoma [ 4 ]

Location

TSS1500 (cg06895831)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:4.52E-05; Z-score:-4.75E-01

Methylation in Case

8.27E-01 (Median) Methylation in Control 8.61E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of ABCA4 in hepatocellular carcinoma [ 4 ]

Location

TSS1500 (cg16298016)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.10E-04; Z-score:-4.95E-01

Methylation in Case

8.61E-01 (Median) Methylation in Control 8.88E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of ABCA4 in hepatocellular carcinoma [ 4 ]

Location

TSS1500 (cg09360041)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:8.76E-04; Z-score:-3.07E-01

Methylation in Case

7.66E-01 (Median) Methylation in Control 7.80E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of ABCA4 in hepatocellular carcinoma [ 4 ]

Location

Body (cg15999077)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.76E+00 Statistic Test p-value:4.38E-24; Z-score:-3.97E+00

Methylation in Case

2.74E-01 (Median) Methylation in Control 4.81E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of ABCA4 in hepatocellular carcinoma [ 4 ]

Location

Body (cg16814060)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.05E+00 Statistic Test p-value:3.75E-22; Z-score:-4.03E+00

Methylation in Case

4.16E-01 (Median) Methylation in Control 8.55E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of ABCA4 in hepatocellular carcinoma [ 4 ]

Location

Body (cg04014105)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.13E+00 Statistic Test p-value:5.12E-16; Z-score:2.62E+00

Methylation in Case

5.13E-01 (Median) Methylation in Control 2.41E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of ABCA4 in hepatocellular carcinoma [ 4 ]

Location

Body (cg13759513)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:3.43E-14; Z-score:1.60E+00

Methylation in Case

8.15E-01 (Median) Methylation in Control 7.34E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of ABCA4 in hepatocellular carcinoma [ 4 ]

Location

Body (cg26068215)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.61E+00 Statistic Test p-value:5.34E-14; Z-score:-3.90E+00

Methylation in Case

4.32E-01 (Median) Methylation in Control 6.96E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of ABCA4 in hepatocellular carcinoma [ 4 ]

Location

Body (cg01629545)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.35E+00 Statistic Test p-value:1.01E-11; Z-score:-2.72E+00

Methylation in Case

4.81E-01 (Median) Methylation in Control 6.50E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of ABCA4 in hepatocellular carcinoma [ 4 ]

Location

Body (cg19241593)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.26E+00 Statistic Test p-value:3.98E-10; Z-score:-1.66E+00

Methylation in Case

6.48E-01 (Median) Methylation in Control 8.19E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of ABCA4 in hepatocellular carcinoma [ 4 ]

Location

Body (cg11592640)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.20E+00 Statistic Test p-value:6.63E-10; Z-score:-2.41E+00

Methylation in Case

6.37E-01 (Median) Methylation in Control 7.61E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of ABCA4 in hepatocellular carcinoma [ 4 ]

Location

Body (cg01922613)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:3.11E-05; Z-score:1.06E+00

Methylation in Case

7.78E-01 (Median) Methylation in Control 7.03E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of ABCA4 in hepatocellular carcinoma [ 4 ]

Location

Body (cg19378389)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:3.30E-05; Z-score:-1.08E+00

Methylation in Case

7.66E-01 (Median) Methylation in Control 8.13E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of ABCA4 in hepatocellular carcinoma [ 4 ]

Location

Body (cg04100956)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:8.45E-05; Z-score:9.67E-01

Methylation in Case

6.54E-01 (Median) Methylation in Control 5.97E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of ABCA4 in hepatocellular carcinoma [ 4 ]

Location

Body (cg21692182)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:1.53E-03; Z-score:-3.17E-01

Methylation in Case

8.90E-01 (Median) Methylation in Control 8.94E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of ABCA4 in hepatocellular carcinoma [ 4 ]

Location

Body (cg01921066)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.32E+00 Statistic Test p-value:1.78E-03; Z-score:-1.41E+00

Methylation in Case

1.97E-01 (Median) Methylation in Control 2.60E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon18

Methylation of ABCA4 in hepatocellular carcinoma [ 4 ]

Location

Body (cg09168805)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:2.92E-03; Z-score:-7.35E-01

Methylation in Case

6.62E-01 (Median) Methylation in Control 6.98E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon19

Methylation of ABCA4 in hepatocellular carcinoma [ 4 ]

Location

Body (cg04491808)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:8.64E-03; Z-score:-4.37E-01

Methylation in Case

6.32E-01 (Median) Methylation in Control 6.62E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon20

Methylation of ABCA4 in hepatocellular carcinoma [ 4 ]

Location

Body (cg26904308)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:4.20E-02; Z-score:-1.78E-01

Methylation in Case

8.12E-01 (Median) Methylation in Control 8.33E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon21

Methylation of ABCA4 in hepatocellular carcinoma [ 4 ]

Location

Body (cg01437135)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:4.44E-02; Z-score:8.98E-02

Methylation in Case

7.18E-01 (Median) Methylation in Control 7.12E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon22

Methylation of ABCA4 in hepatocellular carcinoma [ 4 ]

Location

3'UTR (cg18377941)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.42E+00 Statistic Test p-value:5.11E-08; Z-score:-1.93E+00

Methylation in Case

4.80E-01 (Median) Methylation in Control 6.83E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  HIV infection

         14 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCA4 in HIV infection [ 5 ]

Location

TSS1500 (cg12869058)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:8.89E-05; Z-score:-1.38E+00

Methylation in Case

7.12E-01 (Median) Methylation in Control 7.62E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of ABCA4 in HIV infection [ 5 ]

Location

TSS1500 (cg06895831)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.54E-02; Z-score:-9.30E-01

Methylation in Case

8.70E-01 (Median) Methylation in Control 8.94E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of ABCA4 in HIV infection [ 5 ]

Location

TSS1500 (cg09360041)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:2.32E-02; Z-score:-4.29E-01

Methylation in Case

7.38E-01 (Median) Methylation in Control 7.56E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of ABCA4 in HIV infection [ 5 ]

Location

1stExon (cg04592706)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:2.62E-03; Z-score:-8.18E-01

Methylation in Case

9.34E-01 (Median) Methylation in Control 9.49E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of ABCA4 in HIV infection [ 5 ]

Location

Body (cg18185648)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:3.14E-09; Z-score:2.03E+00

Methylation in Case

8.36E-01 (Median) Methylation in Control 7.48E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of ABCA4 in HIV infection [ 5 ]

Location

Body (cg18800235)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:1.27E-06; Z-score:-2.57E+00

Methylation in Case

8.32E-01 (Median) Methylation in Control 9.11E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of ABCA4 in HIV infection [ 5 ]

Location

Body (cg01437135)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:2.03E-06; Z-score:-2.60E+00

Methylation in Case

7.09E-01 (Median) Methylation in Control 8.05E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of ABCA4 in HIV infection [ 5 ]

Location

Body (cg19378389)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:2.10E-06; Z-score:-2.58E+00

Methylation in Case

8.50E-01 (Median) Methylation in Control 9.21E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of ABCA4 in HIV infection [ 5 ]

Location

Body (cg04491808)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:4.51E-06; Z-score:-1.74E+00

Methylation in Case

5.95E-01 (Median) Methylation in Control 6.74E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of ABCA4 in HIV infection [ 5 ]

Location

Body (cg12600556)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.60E-05; Z-score:-1.00E+00

Methylation in Case

8.43E-01 (Median) Methylation in Control 8.72E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of ABCA4 in HIV infection [ 5 ]

Location

Body (cg14014879)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:2.28E-04; Z-score:8.52E-01

Methylation in Case

8.72E-01 (Median) Methylation in Control 8.54E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of ABCA4 in HIV infection [ 5 ]

Location

Body (cg01807748)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:2.50E-03; Z-score:3.92E-01

Methylation in Case

9.10E-01 (Median) Methylation in Control 9.00E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of ABCA4 in HIV infection [ 5 ]

Location

Body (cg04100956)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:1.48E-02; Z-score:5.19E-01

Methylation in Case

4.30E-01 (Median) Methylation in Control 4.04E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of ABCA4 in HIV infection [ 5 ]

Location

Body (cg04350215)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.27E+00 Statistic Test p-value:1.74E-02; Z-score:1.14E+00

Methylation in Case

6.03E-01 (Median) Methylation in Control 4.75E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

         13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCA4 in lung adenocarcinoma [ 6 ]

Location

TSS1500 (cg12869058)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.22E+00 Statistic Test p-value:4.50E-04; Z-score:-2.21E+00

Methylation in Case

6.04E-01 (Median) Methylation in Control 7.40E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of ABCA4 in lung adenocarcinoma [ 6 ]

Location

TSS1500 (cg09360041)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.24E+00 Statistic Test p-value:1.05E-03; Z-score:-2.28E+00

Methylation in Case

5.77E-01 (Median) Methylation in Control 7.16E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of ABCA4 in lung adenocarcinoma [ 6 ]

Location

TSS1500 (cg06895831)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:4.28E-02; Z-score:-2.74E+00

Methylation in Case

7.55E-01 (Median) Methylation in Control 7.87E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of ABCA4 in lung adenocarcinoma [ 6 ]

Location

Body (cg04491808)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:4.50E-04; Z-score:-3.60E+00

Methylation in Case

6.03E-01 (Median) Methylation in Control 7.05E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of ABCA4 in lung adenocarcinoma [ 6 ]

Location

Body (cg01807748)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.34E+00 Statistic Test p-value:5.75E-04; Z-score:3.53E+00

Methylation in Case

6.72E-01 (Median) Methylation in Control 5.02E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of ABCA4 in lung adenocarcinoma [ 6 ]

Location

Body (cg18185648)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.31E+00 Statistic Test p-value:1.29E-03; Z-score:2.06E+00

Methylation in Case

6.92E-01 (Median) Methylation in Control 5.26E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of ABCA4 in lung adenocarcinoma [ 6 ]

Location

Body (cg01921066)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.29E+00 Statistic Test p-value:1.72E-03; Z-score:2.24E+00

Methylation in Case

3.32E-01 (Median) Methylation in Control 2.58E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of ABCA4 in lung adenocarcinoma [ 6 ]

Location

Body (cg04100956)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.20E+00 Statistic Test p-value:2.98E-03; Z-score:-3.95E+00

Methylation in Case

5.88E-01 (Median) Methylation in Control 7.09E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of ABCA4 in lung adenocarcinoma [ 6 ]

Location

Body (cg19378389)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:7.73E-03; Z-score:-1.35E+00

Methylation in Case

7.92E-01 (Median) Methylation in Control 8.32E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of ABCA4 in lung adenocarcinoma [ 6 ]

Location

Body (cg09168805)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.18E+00 Statistic Test p-value:1.48E-02; Z-score:1.62E+00

Methylation in Case

6.61E-01 (Median) Methylation in Control 5.59E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of ABCA4 in lung adenocarcinoma [ 6 ]

Location

Body (cg12085314)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.40E+00 Statistic Test p-value:2.86E-02; Z-score:1.90E+00

Methylation in Case

8.28E-02 (Median) Methylation in Control 5.90E-02 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of ABCA4 in lung adenocarcinoma [ 6 ]

Location

Body (cg09234454)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:4.54E-02; Z-score:1.27E+00

Methylation in Case

8.80E-01 (Median) Methylation in Control 8.14E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of ABCA4 in lung adenocarcinoma [ 6 ]

Location

3'UTR (cg18377941)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.39E-02; Z-score:-2.26E+00

Methylation in Case

8.75E-01 (Median) Methylation in Control 9.06E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

         16 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCA4 in pancretic ductal adenocarcinoma [ 7 ]

Location

TSS1500 (cg25932807)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.61E+00 Statistic Test p-value:1.06E-20; Z-score:3.38E+00

Methylation in Case

1.21E-01 (Median) Methylation in Control 7.54E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of ABCA4 in pancretic ductal adenocarcinoma [ 7 ]

Location

TSS1500 (cg25241964)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:8.36E-04; Z-score:1.82E-01

Methylation in Case

5.68E-02 (Median) Methylation in Control 5.30E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of ABCA4 in pancretic ductal adenocarcinoma [ 7 ]

Location

TSS1500 (cg11961175)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.22E+00 Statistic Test p-value:1.74E-03; Z-score:-5.65E-01

Methylation in Case

1.01E-01 (Median) Methylation in Control 1.23E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of ABCA4 in pancretic ductal adenocarcinoma [ 7 ]

Location

TSS200 (cg24890054)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.36E+00 Statistic Test p-value:5.34E-19; Z-score:1.11E+00

Methylation in Case

1.13E-01 (Median) Methylation in Control 8.25E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of ABCA4 in pancretic ductal adenocarcinoma [ 7 ]

Location

TSS200 (cg26857910)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.24E+00 Statistic Test p-value:1.09E-10; Z-score:1.22E+00

Methylation in Case

8.39E-02 (Median) Methylation in Control 6.78E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of ABCA4 in pancretic ductal adenocarcinoma [ 7 ]

Location

Body (cg08382534)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.76E+00 Statistic Test p-value:1.59E-53; Z-score:-7.94E+00

Methylation in Case

4.99E-01 (Median) Methylation in Control 8.80E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of ABCA4 in pancretic ductal adenocarcinoma [ 7 ]

Location

Body (cg12558347)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.50E+00 Statistic Test p-value:2.96E-13; Z-score:-2.62E+00

Methylation in Case

3.61E-01 (Median) Methylation in Control 5.41E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of ABCA4 in pancretic ductal adenocarcinoma [ 7 ]

Location

Body (cg11957400)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.31E+00 Statistic Test p-value:2.71E-10; Z-score:1.90E+00

Methylation in Case

5.23E-01 (Median) Methylation in Control 3.99E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of ABCA4 in pancretic ductal adenocarcinoma [ 7 ]

Location

Body (cg20119871)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.10E+00 Statistic Test p-value:7.60E-04; Z-score:1.37E+00

Methylation in Case

7.48E-01 (Median) Methylation in Control 6.80E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of ABCA4 in pancretic ductal adenocarcinoma [ 7 ]

Location

Body (cg26835327)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:3.18E-03; Z-score:-4.51E-01

Methylation in Case

1.07E-01 (Median) Methylation in Control 1.16E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of ABCA4 in pancretic ductal adenocarcinoma [ 7 ]

Location

Body (cg09146645)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:6.96E-03; Z-score:-7.82E-01

Methylation in Case

6.24E-01 (Median) Methylation in Control 6.69E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of ABCA4 in pancretic ductal adenocarcinoma [ 7 ]

Location

Body (cg06713373)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:3.72E-02; Z-score:4.44E-01

Methylation in Case

8.45E-01 (Median) Methylation in Control 8.27E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of ABCA4 in pancretic ductal adenocarcinoma [ 7 ]

Location

Body (cg21946374)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:3.72E-02; Z-score:-2.99E-01

Methylation in Case

7.03E-01 (Median) Methylation in Control 7.31E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of ABCA4 in pancretic ductal adenocarcinoma [ 7 ]

Location

Body (cg02483462)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:3.95E-02; Z-score:7.60E-01

Methylation in Case

5.70E-01 (Median) Methylation in Control 5.25E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of ABCA4 in pancretic ductal adenocarcinoma [ 7 ]

Location

Body (cg18813959)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.00E+00 Statistic Test p-value:4.93E-02; Z-score:1.02E-02

Methylation in Case

8.39E-01 (Median) Methylation in Control 8.39E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of ABCA4 in pancretic ductal adenocarcinoma [ 7 ]

Location

3'UTR (cg15554087)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:3.81E-29; Z-score:-5.71E+00

Methylation in Case

7.31E-01 (Median) Methylation in Control 8.53E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Panic disorder

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCA4 in panic disorder [ 8 ]

Location

TSS1500 (cg16298016)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:3.15E-02; Z-score:3.51E-01

Methylation in Case

1.98E+00 (Median) Methylation in Control 1.85E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of ABCA4 in panic disorder [ 8 ]

Location

Body (cg01437135)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:1.74E-02; Z-score:2.85E-01

Methylation in Case

2.30E+00 (Median) Methylation in Control 2.16E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

         15 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCA4 in papillary thyroid cancer [ 9 ]

Location

TSS1500 (cg12869058)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.96E+00 Statistic Test p-value:4.92E-29; Z-score:-5.63E+00

Methylation in Case

4.26E-01 (Median) Methylation in Control 8.35E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of ABCA4 in papillary thyroid cancer [ 9 ]

Location

TSS1500 (cg09360041)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.95E+00 Statistic Test p-value:2.13E-24; Z-score:-4.41E+00

Methylation in Case

3.82E-01 (Median) Methylation in Control 7.47E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of ABCA4 in papillary thyroid cancer [ 9 ]

Location

TSS1500 (cg14787287)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.24E-03; Z-score:-5.05E-01

Methylation in Case

9.43E-01 (Median) Methylation in Control 9.48E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of ABCA4 in papillary thyroid cancer [ 9 ]

Location

TSS1500 (cg06895831)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:8.14E-03; Z-score:1.01E+00

Methylation in Case

7.96E-01 (Median) Methylation in Control 7.66E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of ABCA4 in papillary thyroid cancer [ 9 ]

Location

TSS1500 (cg16298016)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:1.43E-02; Z-score:4.86E-01

Methylation in Case

9.32E-01 (Median) Methylation in Control 9.26E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of ABCA4 in papillary thyroid cancer [ 9 ]

Location

Body (cg18800235)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.55E+00 Statistic Test p-value:3.98E-22; Z-score:-1.04E+01

Methylation in Case

5.55E-01 (Median) Methylation in Control 8.58E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of ABCA4 in papillary thyroid cancer [ 9 ]

Location

Body (cg09234454)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.23E+00 Statistic Test p-value:2.69E-10; Z-score:-2.70E+00

Methylation in Case

6.32E-01 (Median) Methylation in Control 7.79E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of ABCA4 in papillary thyroid cancer [ 9 ]

Location

Body (cg01921066)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.36E+00 Statistic Test p-value:9.65E-08; Z-score:-1.40E+00

Methylation in Case

1.75E-01 (Median) Methylation in Control 2.39E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of ABCA4 in papillary thyroid cancer [ 9 ]

Location

Body (cg26904308)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:9.79E-07; Z-score:1.05E+00

Methylation in Case

9.12E-01 (Median) Methylation in Control 8.80E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of ABCA4 in papillary thyroid cancer [ 9 ]

Location

Body (cg09168805)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.10E+00 Statistic Test p-value:2.20E-05; Z-score:1.24E+00

Methylation in Case

6.72E-01 (Median) Methylation in Control 6.11E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of ABCA4 in papillary thyroid cancer [ 9 ]

Location

Body (cg01922613)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.18E+00 Statistic Test p-value:2.47E-03; Z-score:-8.00E-01

Methylation in Case

3.53E-01 (Median) Methylation in Control 4.17E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of ABCA4 in papillary thyroid cancer [ 9 ]

Location

Body (cg04491808)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:5.81E-03; Z-score:-5.30E-01

Methylation in Case

8.51E-01 (Median) Methylation in Control 8.80E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of ABCA4 in papillary thyroid cancer [ 9 ]

Location

Body (cg18185648)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.26E+00 Statistic Test p-value:6.32E-03; Z-score:6.59E-01

Methylation in Case

2.29E-01 (Median) Methylation in Control 1.82E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of ABCA4 in papillary thyroid cancer [ 9 ]

Location

Body (cg12600556)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:8.91E-03; Z-score:-1.68E-01

Methylation in Case

8.79E-01 (Median) Methylation in Control 8.83E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of ABCA4 in papillary thyroid cancer [ 9 ]

Location

Body (cg01437135)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:1.57E-02; Z-score:4.14E-01

Methylation in Case

2.90E-01 (Median) Methylation in Control 2.67E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Prostate cancer

           7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCA4 in prostate cancer [ 10 ]

Location

TSS1500 (cg01517431)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:3.68E-02; Z-score:1.85E+00

Methylation in Case

8.88E-01 (Median) Methylation in Control 7.63E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of ABCA4 in prostate cancer [ 10 ]

Location

TSS1500 (cg21881273)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.21E+00 Statistic Test p-value:4.96E-02; Z-score:3.09E+00

Methylation in Case

7.67E-02 (Median) Methylation in Control 3.47E-02 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of ABCA4 in prostate cancer [ 10 ]

Location

TSS200 (cg01323777)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.43E+00 Statistic Test p-value:2.75E-02; Z-score:1.85E+00

Methylation in Case

8.39E-01 (Median) Methylation in Control 5.86E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of ABCA4 in prostate cancer [ 10 ]

Location

Body (cg23638455)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.63E+00 Statistic Test p-value:6.09E-03; Z-score:2.82E+00

Methylation in Case

8.45E-01 (Median) Methylation in Control 5.19E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of ABCA4 in prostate cancer [ 10 ]

Location

Body (cg23958868)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.59E+00 Statistic Test p-value:1.32E-02; Z-score:-2.79E+00

Methylation in Case

3.53E-01 (Median) Methylation in Control 5.61E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of ABCA4 in prostate cancer [ 10 ]

Location

3'UTR (cg26270695)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.54E+00 Statistic Test p-value:1.16E-02; Z-score:-3.86E+00

Methylation in Case

3.37E-01 (Median) Methylation in Control 5.19E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

         15 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCA4 in atypical teratoid rhabdoid tumor [ 11 ]

Location

1stExon (cg04592706)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.55E+00 Statistic Test p-value:1.25E-24; Z-score:-3.36E+00

Methylation in Case

4.05E-01 (Median) Methylation in Control 6.27E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of ABCA4 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg01437135)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.10E+00 Statistic Test p-value:6.71E-05; Z-score:9.48E-01

Methylation in Case

8.90E-01 (Median) Methylation in Control 8.09E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of ABCA4 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg01807748)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:8.35E-05; Z-score:6.88E-01

Methylation in Case

8.33E-01 (Median) Methylation in Control 7.38E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of ABCA4 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg01921066)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.04E+00 Statistic Test p-value:9.52E-05; Z-score:-1.45E+00

Methylation in Case

2.00E-01 (Median) Methylation in Control 4.07E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of ABCA4 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg01922613)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:1.02E-04; Z-score:-1.13E+00

Methylation in Case

7.52E-01 (Median) Methylation in Control 8.37E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of ABCA4 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg04100956)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:5.56E-04; Z-score:-7.14E-01

Methylation in Case

8.47E-01 (Median) Methylation in Control 8.78E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of ABCA4 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg04350215)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:7.33E-04; Z-score:-4.57E-01

Methylation in Case

7.11E-01 (Median) Methylation in Control 7.61E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of ABCA4 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg04491808)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:8.49E-04; Z-score:5.60E-01

Methylation in Case

8.19E-01 (Median) Methylation in Control 7.33E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of ABCA4 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg09168805)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.28E+00 Statistic Test p-value:9.53E-03; Z-score:-6.82E-01

Methylation in Case

1.36E-01 (Median) Methylation in Control 1.73E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of ABCA4 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg09234454)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:9.70E-03; Z-score:2.19E-01

Methylation in Case

1.11E-01 (Median) Methylation in Control 1.07E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of ABCA4 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg09326529)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:9.87E-03; Z-score:-2.03E-01

Methylation in Case

1.07E-01 (Median) Methylation in Control 1.14E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of ABCA4 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg12085314)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:2.66E-02; Z-score:-4.62E-01

Methylation in Case

6.43E-01 (Median) Methylation in Control 6.97E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of ABCA4 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg12600556)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.16E+00 Statistic Test p-value:2.84E-02; Z-score:-2.44E-01

Methylation in Case

1.70E-01 (Median) Methylation in Control 1.97E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of ABCA4 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg14014879)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:4.21E-02; Z-score:-5.86E-01

Methylation in Case

5.51E-01 (Median) Methylation in Control 6.04E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of ABCA4 in atypical teratoid rhabdoid tumor [ 11 ]

Location

3'UTR (cg18377941)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:1.46E-10; Z-score:-1.61E+00

Methylation in Case

7.78E-01 (Median) Methylation in Control 8.77E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Depression

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCA4 in depression [ 12 ]

Location

Body (cg12085314)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:8.69E-03; Z-score:-4.44E-01

Methylation in Case

3.94E-02 (Median) Methylation in Control 4.69E-02 (Median)

Studied Phenotype

Depression[ ICD-11:6A8Z]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCA4 in systemic lupus erythematosus [ 13 ]

Location

Body (cg12600556)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.83E-02; Z-score:-2.14E-01

Methylation in Case

8.54E-01 (Median) Methylation in Control 8.62E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of ABCA4 in systemic lupus erythematosus [ 13 ]

Location

Body (cg01921066)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:2.26E-02; Z-score:-1.57E-01

Methylation in Case

5.05E-01 (Median) Methylation in Control 5.16E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of ABCA4 in systemic lupus erythematosus [ 13 ]

Location

Body (cg19378389)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.31E-02; Z-score:-1.67E-01

Methylation in Case

8.38E-01 (Median) Methylation in Control 8.50E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Anaplastic pleomorphic xanthoastrocytoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypermethylation of ABCA4 in anaplastic pleomorphic xanthoastrocytoma than that in healthy individual

Studied Phenotype

Anaplastic pleomorphic xanthoastrocytoma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.67E-07; Fold-change:0.221907876; Z-score:1.821192192
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Arterial aneurysm

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypermethylation of ABCA4 in arterial aneurysm than that in healthy individual

Studied Phenotype

Arterial aneurysm [ICD-11:BD51]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.00055652; Fold-change:0.242898892; Z-score:5.843915298
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals

  Lymphoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypermethylation of ABCA4 in lymphoma than that in healthy individual

Studied Phenotype

Lymphoma [ICD-11:2B30]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.14E-10; Fold-change:0.22170038; Z-score:1.526244033
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Melanocytoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypermethylation of ABCA4 in melanocytoma than that in healthy individual

Studied Phenotype

Melanocytoma [ICD-11:2F36.2]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:4.15E-08; Fold-change:0.249667316; Z-score:2.453350993
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Oligodendroglial tumour

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypermethylation of ABCA4 in oligodendroglial tumour than that in healthy individual

Studied Phenotype

Oligodendroglial tumour [ICD-11:2A00.Y1]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.026268836; Fold-change:0.246497124; Z-score:1.379159806
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Oligodendroglioma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypermethylation of ABCA4 in oligodendroglioma than that in healthy individual

Studied Phenotype

Oligodendroglioma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:5.04E-18; Fold-change:0.236878266; Z-score:1.624720324
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Peripheral neuroectodermal tumour

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypermethylation of ABCA4 in peripheral neuroectodermal tumour than that in healthy individual

Studied Phenotype

Peripheral neuroectodermal tumour [ICD-11:2B52]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.10E-08; Fold-change:0.210296803; Z-score:1.672611175
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Cerebral hemispheric glioma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of ABCA4 in cerebral hemispheric glioma than that in healthy individual

Studied Phenotype

Cerebral hemispheric glioma [ICD-11:2A00.5]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.019878972; Fold-change:-0.216225131; Z-score:-1.248388168
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Esthesioneuroblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of ABCA4 in esthesioneuroblastoma than that in healthy individual

Studied Phenotype

Esthesioneuroblastoma [ICD-11:2D50.1]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.39E-13; Fold-change:-0.271965996; Z-score:-2.235223894
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Pituitary adenoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of ABCA4 in pituitary adenoma than that in healthy individual

Studied Phenotype

Pituitary adenoma [ICD-11:2F37]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.49E-06; Fold-change:-0.2262136; Z-score:-4.427799828
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Medulloblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of ABCA4 in medulloblastoma than that in healthy individual

Studied Phenotype

Medulloblastoma [ICD-11:2A00.10]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:5.58E-65; Fold-change:-0.690513994; Z-score:-3.86036073
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Gastric cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypermethylation of ABCA4 in gastric cancer than that in adjacent tissue

Studied Phenotype

Gastric cancer [ICD-11:2B72]

The Methylation Level of Disease Section Compare with the Adjacent Tissue

p-value:0.02387577; Fold-change:0.206851018; Z-score:3.808209408
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals

  Renal cell carcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of ABCA4 in renal cell carcinoma than that in adjacent tissue

Studied Phenotype

Renal cell carcinoma [ICD-11:2C90]

The Methylation Level of Disease Section Compare with the Adjacent Tissue

p-value:2.23E-10; Fold-change:-0.249053986; Z-score:-3.393909641
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients

microRNA

  Unclear Phenotype

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-335 directly targets ABCA4 [ 14 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
5 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
6 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
7 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
8 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
9 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
11 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
12 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
13 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
14 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.