Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0015 Transporter Info
Gene Name ABCC4
Transporter Name Multidrug resistance-associated protein 4
Gene ID
10257
UniProt ID
O15439
Epigenetic Regulations of This DT (EGR)

Histone acetylation

  Breast cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Hypoacetylation of ABCC1 in Breast cancer [ 10 ]

Location

 Promoter

Epigenetic Type

 Histone acetylation Experiment Method .

Related Molecular Changes

 Up regulation ofABCC4 Experiment Method RT-qPCR and Western blot

Studied Phenotype

 Breast cancer[ ICD-11:2C60]

Experimental Material

 T47D/SN120 and T47D/SN150 breast cancer sublines

Additional Notes

 MRP4 overexpression in SN38-resistant T47D cells associated with the suppression of epigenetic gene silencing via DNA hypermethylation and histone deacetylation.

Methylation

  Bladder cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of ABCC4 in bladder cancer [ 1 ]

Location

 Body (cg14808360)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.10E+00 Statistic Test p-value:2.31E-04; Z-score:4.32E+00

Methylation in Case

 9.07E-01 (Median) Methylation in Control 8.27E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of ABCC4 in breast cancer [ 2 ]

Location

 Body (cg14808360)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.00E+00 Statistic Test p-value:3.52E-04; Z-score:8.22E-02

Methylation in Case

 8.93E-01 (Median) Methylation in Control 8.91E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of ABCC4 in breast cancer [ 2 ]

Location

 3'UTR (cg10272922)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.03E+00 Statistic Test p-value:2.89E-04; Z-score:-4.94E-01

Methylation in Case

 7.64E-01 (Median) Methylation in Control 7.85E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Hypomethylation of ABCC1 in Breast cancer [ 10 ]

Location

 Promoter

Epigenetic Type

 Methylation Experiment Method .

Related Molecular Changes

 Up regulation ofABCC4 Experiment Method RT-qPCR and Western blot

Studied Phenotype

 Breast cancer[ ICD-11:2C60]

Experimental Material

 T47D/SN120 and T47D/SN150 breast cancer sublines

Additional Notes

 MRP4 overexpression in SN38-resistant T47D cells associated with the suppression of epigenetic gene silencing via DNA hypermethylation and histone deacetylation.

  Colorectal cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of ABCC4 in colorectal cancer [ 3 ]

Location

 Body (cg14808360)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.01E+00 Statistic Test p-value:1.45E-02; Z-score:9.84E-01

Methylation in Case

 9.53E-01 (Median) Methylation in Control 9.41E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of ABCC4 in colorectal cancer [ 3 ]

Location

 3'UTR (cg10272922)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.02E+00 Statistic Test p-value:1.89E-05; Z-score:-1.40E+00

Methylation in Case

 9.15E-01 (Median) Methylation in Control 9.36E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of ABCC4 in hepatocellular carcinoma [ 4 ]

Location

 Body (cg14808360)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:1.74E-03; Z-score:-1.36E-01

Methylation in Case

 8.89E-01 (Median) Methylation in Control 8.94E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of ABCC4 in hepatocellular carcinoma [ 4 ]

Location

 3'UTR (cg10272922)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.04E+00 Statistic Test p-value:7.42E-05; Z-score:-4.69E-01

Methylation in Case

 8.22E-01 (Median) Methylation in Control 8.55E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of ABCC4 in pancretic ductal adenocarcinoma [ 5 ]

Location

 Body (cg18892212)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.30E+00 Statistic Test p-value:6.77E-06; Z-score:1.02E+00

Methylation in Case

 5.15E-01 (Median) Methylation in Control 3.96E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of ABCC4 in pancretic ductal adenocarcinoma [ 5 ]

Location

 3'UTR (cg23859051)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.30E+00 Statistic Test p-value:9.40E-06; Z-score:1.51E+00

Methylation in Case

 7.45E-01 (Median) Methylation in Control 5.74E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of ABCC4 in papillary thyroid cancer [ 6 ]

Location

 Body (cg14808360)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.11E+00 Statistic Test p-value:1.20E-07; Z-score:1.50E+00

Methylation in Case

 9.06E-01 (Median) Methylation in Control 8.19E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of ABCC4 in papillary thyroid cancer [ 6 ]

Location

 3'UTR (cg10272922)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.02E+00 Statistic Test p-value:3.12E-05; Z-score:-1.15E+00

Methylation in Case

 8.95E-01 (Median) Methylation in Control 9.16E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of ABCC4 in atypical teratoid rhabdoid tumor [ 7 ]

Location

 3'UTR (cg10272922)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.39E+00 Statistic Test p-value:2.56E-12; Z-score:1.74E+00

Methylation in Case

 1.88E-01 (Median) Methylation in Control 1.36E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  HIV infection

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of ABCC4 in HIV infection [ 8 ]

Location

 3'UTR (cg10272922)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.02E+00 Statistic Test p-value:5.96E-06; Z-score:7.42E-01

Methylation in Case

 9.27E-01 (Median) Methylation in Control 9.10E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of ABCC4 in systemic lupus erythematosus [ 9 ]

Location

 3'UTR (cg10272922)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:2.73E-02; Z-score:-2.26E-01

Methylation in Case

 9.08E-01 (Median) Methylation in Control 9.13E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

 Patient tissue samples

  Diabetes

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Hypomethylation of ABCC4 in diabetic mice [ 12 ]

Location

 Promoter

Epigenetic Type

 Methylation Experiment Method Microarray

Studied Phenotype

 Diabetes[ ICD-11:5A10-5A14]

Experimental Material

 Model organism in vivo (mouse)

Additional Notes

 Hypermethylation of SLCO1A1 was observed in diabetic mice

microRNA

  Hepatocellular carcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Lower expression of miR-124a in hepatocellular carcinoma (compare with NRTIs treatment cells) [ 11 ]

Epigenetic Type

 microRNA Experiment Method .

Related Molecular Changes

 Down regulation ofABCC4 Experiment Method Western Blot

miRNA Stemloop ID

 miR-124a miRNA Mature ID Unclear

miRNA Target Type

 Direct

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Human hepatocellular carcinoma cell line (HepG2)

Additional Notes

 Inverse association between microRNA-124a and ABCC4 in HepG2 cells treated with antiretroviral drugs.

  Unclear Phenotype

          20 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 let-7a directly targets ABCC4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7a miRNA Mature ID let-7a-3p

miRNA Sequence

 CUAUACAAUCUACUGUCUUUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon2

 let-7b directly targets ABCC4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7b miRNA Mature ID let-7b-3p

miRNA Sequence

 CUAUACAACCUACUGCCUUCCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon3

 let-7f-1 directly targets ABCC4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7f-1 miRNA Mature ID let-7f-1-3p

miRNA Sequence

 CUAUACAAUCUAUUGCCUUCCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon4

 miR-1 directly targets ABCC4 [ 14 ]

Epigenetic Type

 microRNA Experiment Method Proteomics

miRNA Stemloop ID

 miR-1 miRNA Mature ID miR-1-3p

miRNA Sequence

 UGGAAUGUAAAGAAGUAUGUAU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon5

 miR-105 directly targets ABCC4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-105 miRNA Mature ID miR-105-5p

miRNA Sequence

 UCAAAUGCUCAGACUCCUGUGGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon6

 miR-125b directly targets ABCC4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-125b miRNA Mature ID miR-125b-5p

miRNA Sequence

 UCCCUGAGACCCUAACUUGUGA

miRNA Target Type

 Direct

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 miR-1277 directly targets ABCC4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1277 miRNA Mature ID miR-1277-5p

miRNA Sequence

 AAAUAUAUAUAUAUAUGUACGUAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon8

 miR-155 directly targets ABCC4 [ 14 ]

Epigenetic Type

 microRNA Experiment Method Proteomics

miRNA Stemloop ID

 miR-155 miRNA Mature ID miR-155-5p

miRNA Sequence

 UUAAUGCUAAUCGUGAUAGGGGUU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon9

 miR-16 directly targets ABCC4 [ 14 ]

Epigenetic Type

 microRNA Experiment Method Proteomics

miRNA Stemloop ID

 miR-16 miRNA Mature ID miR-16-5p

miRNA Sequence

 UAGCAGCACGUAAAUAUUGGCG

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon10

 miR-23b directly targets ABCC4 [ 16 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-23b miRNA Mature ID miR-23b-3p

miRNA Sequence

 AUCACAUUGCCAGGGAUUACCAC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon11

 miR-300 directly targets ABCC4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-300 miRNA Mature ID miR-300

miRNA Sequence

 UAUACAAGGGCAGACUCUCUCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon12

 miR-324 directly targets ABCC4 [ 16 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-324 miRNA Mature ID miR-324-5p

miRNA Sequence

 CGCAUCCCCUAGGGCAUUGGUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon13

 miR-381 directly targets ABCC4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-381 miRNA Mature ID miR-381-3p

miRNA Sequence

 UAUACAAGGGCAAGCUCUCUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon14

 miR-3924 directly targets ABCC4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3924 miRNA Mature ID miR-3924

miRNA Sequence

 AUAUGUAUAUGUGACUGCUACU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon15

 miR-4666a directly targets ABCC4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4666a miRNA Mature ID miR-4666a-3p

miRNA Sequence

 CAUACAAUCUGACAUGUAUUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon16

 miR-7-1 directly targets ABCC4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7-1 miRNA Mature ID miR-7-1-3p

miRNA Sequence

 CAACAAAUCACAGUCUGCCAUA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon17

 miR-7-2 directly targets ABCC4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7-2 miRNA Mature ID miR-7-2-3p

miRNA Sequence

 CAACAAAUCCCAGUCUACCUAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon18

 miR-7853 directly targets ABCC4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7853 miRNA Mature ID miR-7853-5p

miRNA Sequence

 UCAAAUGCAGAUCCUGACUUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon19

 miR-8064 directly targets ABCC4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-8064 miRNA Mature ID miR-8064

miRNA Sequence

 AGCACACUGAGCGAGCGGAC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon20

 miR-98 directly targets ABCC4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-98 miRNA Mature ID miR-98-3p

miRNA Sequence

 CUAUACAACUUACUACUUUCCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
5 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
6 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
7 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
8 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
10 Characterization of SN38-resistant T47D breast cancer cell sublines overexpressing BCRP, MRP1, MRP2, MRP3, and MRP4. BMC Cancer. 2022 Apr 23;22(1):446.
11 Inverse association between microRNA-124a and ABCC4 in HepG2 cells treated with antiretroviral drugs. Xenobiotica. 2016 Sep;46(9):825-30.
12 Diabetes Induces Aberrant DNA Methylation in the Proximal Tubules of the Kidney. J Am Soc Nephrol. 2015 Oct;26(10):2388-97.
13 Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.
14 Widespread changes in protein synthesis induced by microRNAs. Nature. 2008 Sep 4;455(7209):58-63.
15 Widespread deregulation of microRNA expression in human prostate cancer. Oncogene. 2008 Mar 13;27(12):1788-93.
16 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.