Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0015 Transporter Info | ||||
Gene Name | ABCC4 | ||||
Transporter Name | Multidrug resistance-associated protein 4 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
Histone acetylation |
|||||
Breast cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Hypoacetylation of ABCC1 in Breast cancer | [ 10 ] | |||
Location |
Promoter | ||||
Epigenetic Type |
Histone acetylation | Experiment Method | . | ||
Related Molecular Changes | Up regulation ofABCC4 | Experiment Method | RT-qPCR and Western blot | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60] | ||||
Experimental Material |
T47D/SN120 and T47D/SN150 breast cancer sublines | ||||
Additional Notes |
MRP4 overexpression in SN38-resistant T47D cells associated with the suppression of epigenetic gene silencing via DNA hypermethylation and histone deacetylation. | ||||
Methylation |
|||||
Bladder cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of ABCC4 in bladder cancer | [ 1 ] | |||
Location |
Body (cg14808360) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.10E+00 | Statistic Test | p-value:2.31E-04; Z-score:4.32E+00 | ||
Methylation in Case |
9.07E-01 (Median) | Methylation in Control | 8.27E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Breast cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of ABCC4 in breast cancer | [ 2 ] | |||
Location |
Body (cg14808360) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.00E+00 | Statistic Test | p-value:3.52E-04; Z-score:8.22E-02 | ||
Methylation in Case |
8.93E-01 (Median) | Methylation in Control | 8.91E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of ABCC4 in breast cancer | [ 2 ] | |||
Location |
3'UTR (cg10272922) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:2.89E-04; Z-score:-4.94E-01 | ||
Methylation in Case |
7.64E-01 (Median) | Methylation in Control | 7.85E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Hypomethylation of ABCC1 in Breast cancer | [ 10 ] | |||
Location |
Promoter | ||||
Epigenetic Type |
Methylation | Experiment Method | . | ||
Related Molecular Changes | Up regulation ofABCC4 | Experiment Method | RT-qPCR and Western blot | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60] | ||||
Experimental Material |
T47D/SN120 and T47D/SN150 breast cancer sublines | ||||
Additional Notes |
MRP4 overexpression in SN38-resistant T47D cells associated with the suppression of epigenetic gene silencing via DNA hypermethylation and histone deacetylation. | ||||
Colorectal cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of ABCC4 in colorectal cancer | [ 3 ] | |||
Location |
Body (cg14808360) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:1.45E-02; Z-score:9.84E-01 | ||
Methylation in Case |
9.53E-01 (Median) | Methylation in Control | 9.41E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of ABCC4 in colorectal cancer | [ 3 ] | |||
Location |
3'UTR (cg10272922) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.89E-05; Z-score:-1.40E+00 | ||
Methylation in Case |
9.15E-01 (Median) | Methylation in Control | 9.36E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Hepatocellular carcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of ABCC4 in hepatocellular carcinoma | [ 4 ] | |||
Location |
Body (cg14808360) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.74E-03; Z-score:-1.36E-01 | ||
Methylation in Case |
8.89E-01 (Median) | Methylation in Control | 8.94E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of ABCC4 in hepatocellular carcinoma | [ 4 ] | |||
Location |
3'UTR (cg10272922) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:7.42E-05; Z-score:-4.69E-01 | ||
Methylation in Case |
8.22E-01 (Median) | Methylation in Control | 8.55E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Pancretic ductal adenocarcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of ABCC4 in pancretic ductal adenocarcinoma | [ 5 ] | |||
Location |
Body (cg18892212) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.30E+00 | Statistic Test | p-value:6.77E-06; Z-score:1.02E+00 | ||
Methylation in Case |
5.15E-01 (Median) | Methylation in Control | 3.96E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of ABCC4 in pancretic ductal adenocarcinoma | [ 5 ] | |||
Location |
3'UTR (cg23859051) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.30E+00 | Statistic Test | p-value:9.40E-06; Z-score:1.51E+00 | ||
Methylation in Case |
7.45E-01 (Median) | Methylation in Control | 5.74E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Papillary thyroid cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of ABCC4 in papillary thyroid cancer | [ 6 ] | |||
Location |
Body (cg14808360) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:1.20E-07; Z-score:1.50E+00 | ||
Methylation in Case |
9.06E-01 (Median) | Methylation in Control | 8.19E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of ABCC4 in papillary thyroid cancer | [ 6 ] | |||
Location |
3'UTR (cg10272922) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:3.12E-05; Z-score:-1.15E+00 | ||
Methylation in Case |
8.95E-01 (Median) | Methylation in Control | 9.16E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Atypical teratoid rhabdoid tumor |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of ABCC4 in atypical teratoid rhabdoid tumor | [ 7 ] | |||
Location |
3'UTR (cg10272922) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.39E+00 | Statistic Test | p-value:2.56E-12; Z-score:1.74E+00 | ||
Methylation in Case |
1.88E-01 (Median) | Methylation in Control | 1.36E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
HIV infection |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of ABCC4 in HIV infection | [ 8 ] | |||
Location |
3'UTR (cg10272922) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:5.96E-06; Z-score:7.42E-01 | ||
Methylation in Case |
9.27E-01 (Median) | Methylation in Control | 9.10E-01 (Median) | ||
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Systemic lupus erythematosus |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of ABCC4 in systemic lupus erythematosus | [ 9 ] | |||
Location |
3'UTR (cg10272922) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:2.73E-02; Z-score:-2.26E-01 | ||
Methylation in Case |
9.08E-01 (Median) | Methylation in Control | 9.13E-01 (Median) | ||
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Diabetes |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Hypomethylation of ABCC4 in diabetic mice | [ 12 ] | |||
Location |
Promoter | ||||
Epigenetic Type |
Methylation | Experiment Method | Microarray | ||
Studied Phenotype |
Diabetes[ ICD-11:5A10-5A14] | ||||
Experimental Material |
Model organism in vivo (mouse) | ||||
Additional Notes |
Hypermethylation of SLCO1A1 was observed in diabetic mice | ||||
microRNA |
|||||
Hepatocellular carcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Lower expression of miR-124a in hepatocellular carcinoma (compare with NRTIs treatment cells) | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | . | ||
Related Molecular Changes | Down regulation ofABCC4 | Experiment Method | Western Blot | ||
miRNA Stemloop ID |
miR-124a | miRNA Mature ID | Unclear | ||
miRNA Target Type |
Direct | ||||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Human hepatocellular carcinoma cell line (HepG2) | ||||
Additional Notes |
Inverse association between microRNA-124a and ABCC4 in HepG2 cells treated with antiretroviral drugs. | ||||
Unclear Phenotype |
20 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
let-7a directly targets ABCC4 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
let-7a | miRNA Mature ID | let-7a-3p | ||
miRNA Sequence |
CUAUACAAUCUACUGUCUUUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon2 |
let-7b directly targets ABCC4 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
let-7b | miRNA Mature ID | let-7b-3p | ||
miRNA Sequence |
CUAUACAACCUACUGCCUUCCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon3 |
let-7f-1 directly targets ABCC4 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
let-7f-1 | miRNA Mature ID | let-7f-1-3p | ||
miRNA Sequence |
CUAUACAAUCUAUUGCCUUCCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon4 |
miR-1 directly targets ABCC4 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Proteomics | ||
miRNA Stemloop ID |
miR-1 | miRNA Mature ID | miR-1-3p | ||
miRNA Sequence |
UGGAAUGUAAAGAAGUAUGUAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
Epigenetic Phenomenon5 |
miR-105 directly targets ABCC4 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-105 | miRNA Mature ID | miR-105-5p | ||
miRNA Sequence |
UCAAAUGCUCAGACUCCUGUGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon6 |
miR-125b directly targets ABCC4 | [ 15 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-125b | miRNA Mature ID | miR-125b-5p | ||
miRNA Sequence |
UCCCUGAGACCCUAACUUGUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon7 |
miR-1277 directly targets ABCC4 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1277 | miRNA Mature ID | miR-1277-5p | ||
miRNA Sequence |
AAAUAUAUAUAUAUAUGUACGUAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon8 |
miR-155 directly targets ABCC4 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Proteomics | ||
miRNA Stemloop ID |
miR-155 | miRNA Mature ID | miR-155-5p | ||
miRNA Sequence |
UUAAUGCUAAUCGUGAUAGGGGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
Epigenetic Phenomenon9 |
miR-16 directly targets ABCC4 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Proteomics | ||
miRNA Stemloop ID |
miR-16 | miRNA Mature ID | miR-16-5p | ||
miRNA Sequence |
UAGCAGCACGUAAAUAUUGGCG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
Epigenetic Phenomenon10 |
miR-23b directly targets ABCC4 | [ 16 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-23b | miRNA Mature ID | miR-23b-3p | ||
miRNA Sequence |
AUCACAUUGCCAGGGAUUACCAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon11 |
miR-300 directly targets ABCC4 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-300 | miRNA Mature ID | miR-300 | ||
miRNA Sequence |
UAUACAAGGGCAGACUCUCUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon12 |
miR-324 directly targets ABCC4 | [ 16 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-324 | miRNA Mature ID | miR-324-5p | ||
miRNA Sequence |
CGCAUCCCCUAGGGCAUUGGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon13 |
miR-381 directly targets ABCC4 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-381 | miRNA Mature ID | miR-381-3p | ||
miRNA Sequence |
UAUACAAGGGCAAGCUCUCUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon14 |
miR-3924 directly targets ABCC4 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3924 | miRNA Mature ID | miR-3924 | ||
miRNA Sequence |
AUAUGUAUAUGUGACUGCUACU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon15 |
miR-4666a directly targets ABCC4 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4666a | miRNA Mature ID | miR-4666a-3p | ||
miRNA Sequence |
CAUACAAUCUGACAUGUAUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon16 |
miR-7-1 directly targets ABCC4 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-7-1 | miRNA Mature ID | miR-7-1-3p | ||
miRNA Sequence |
CAACAAAUCACAGUCUGCCAUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon17 |
miR-7-2 directly targets ABCC4 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-7-2 | miRNA Mature ID | miR-7-2-3p | ||
miRNA Sequence |
CAACAAAUCCCAGUCUACCUAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon18 |
miR-7853 directly targets ABCC4 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-7853 | miRNA Mature ID | miR-7853-5p | ||
miRNA Sequence |
UCAAAUGCAGAUCCUGACUUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon19 |
miR-8064 directly targets ABCC4 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-8064 | miRNA Mature ID | miR-8064 | ||
miRNA Sequence |
AGCACACUGAGCGAGCGGAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon20 |
miR-98 directly targets ABCC4 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-98 | miRNA Mature ID | miR-98-3p | ||
miRNA Sequence |
CUAUACAACUUACUACUUUCCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.