Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0006 Transporter Info | ||||
Gene Name | SLC22A2 | ||||
Transporter Name | Organic cation transporter 2 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
Methylation |
|||||
Renal cell carcinoma |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Hypermethylation of SLC22A2 in renal cell carcinoma | [ 1 ] | |||
Location |
Proximal promoter | ||||
Epigenetic Type |
Methylation | Experiment Method | Bisulfite sequencing | ||
Related Molecular Changes | Down regulation ofSLC22A2 | Experiment Method | RT-qPCR | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Frequency |
70% of the studied tumor samples | ||||
Experimental Material |
Patient tissue samples | ||||
Additional Notes |
All CpG sites in the OCT2 proximal promoter were hypomethylated in the kidney. | ||||
Epigenetic Phenomenon2 |
Hypermethylation of SLC22A2 in renal cell carcinoma | [ 2 ] | |||
Location |
Promoter | ||||
Epigenetic Type |
Methylation | Experiment Method | Bisulfite sequencing PCR | ||
Related Molecular Changes | Down regulation ofSLC22A2 | Experiment Method | RT-qPCR | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Frequency |
In all three RCC lines (786-O, 769-P, and Caki-1) | ||||
Experimental Material |
Multiple cell lines of human; Patients tissue samples | ||||
Additional Notes |
DNA Hypermethylation blocked MYC activation of OCT2 by disrupting its interaction with the E-Box motif, which prevented MYC from recruiting MLL1 to catalyze H3K4me3 at the OCT2 promoter and resulted in repressed OCT2 transcription. | ||||
Epigenetic Phenomenon3 |
Hypermethylation of SLC22A2 in renal cell carcinoma | [ 5 ] | |||
Location |
Promoter (10 CpG sites) | ||||
Epigenetic Type |
Methylation | Experiment Method | HumanMethylation450 BeadChip | ||
Related Molecular Changes | Down regulation ofSLC22A2 | Experiment Method | Affymetrix Human Transcriptome 2.0 microarrays | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Multiple cell lines of human | ||||
Additional Notes |
In RCC cell lines, OCT2 protein expression is downregulated due to Hypermethylation in the SLC22A2 promoter region compared to primary tumors or metastases. | ||||
Esophageal cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Hypermethylation of SLC22A2 in cisplatin-resistant esophageal cancer (compare with parental cells) | [ 3 ] | |||
Location |
Promoter | ||||
Epigenetic Type |
Methylation | Experiment Method | Methylation-sensitive PCR | ||
Related Molecular Changes | Down regulation ofSLC22A2 | Experiment Method | Western Blot | ||
Studied Phenotype |
Esophageal cancer[ ICD-11:2B70] | ||||
Experimental Material |
Patient tissue samples | ||||
Additional Notes |
Long-term exposure to cisplatin promotes methylation of the OCT1 gene in human esophageal cancer cells. | ||||
Hepatocellular carcinoma |
12 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Hypermethylation of SLC22A2 in hepatocellular carcinoma (compare with non-tumor adjacent tissues) | [ 4 ] | |||
Location |
Promoter | ||||
Epigenetic Type |
Methylation | Experiment Method | MALDI-TOF MS | ||
Related Molecular Changes | Down regulation ofSLC22A2 | Experiment Method | RT-qPCR | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Additional Notes |
DNA methylation is associated with downregulation of the organic cation transporter OCT1 (SLC22A1) in human hepatocellular carcinoma. | ||||
Epigenetic Phenomenon2 |
Methylation of SLC22A2 in hepatocellular carcinoma | [ 12 ] | |||
Location |
TSS1500 (cg07026448) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.16E+00 | Statistic Test | p-value:1.17E-08; Z-score:1.41E+00 | ||
Methylation in Case |
6.40E-01 (Median) | Methylation in Control | 5.50E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC22A2 in hepatocellular carcinoma | [ 12 ] | |||
Location |
TSS1500 (cg23995605) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:8.40E-03; Z-score:-3.12E-01 | ||
Methylation in Case |
8.79E-01 (Median) | Methylation in Control | 8.87E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC22A2 in hepatocellular carcinoma | [ 12 ] | |||
Location |
TSS1500 (cg14450766) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:3.95E-02; Z-score:3.63E-01 | ||
Methylation in Case |
4.92E-01 (Median) | Methylation in Control | 4.61E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC22A2 in hepatocellular carcinoma | [ 12 ] | |||
Location |
TSS200 (cg06236276) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:8.34E-03; Z-score:1.72E-01 | ||
Methylation in Case |
6.85E-01 (Median) | Methylation in Control | 6.60E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon6 |
Methylation of SLC22A2 in hepatocellular carcinoma | [ 12 ] | |||
Location |
Body (cg10473100) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.24E+00 | Statistic Test | p-value:6.30E-12; Z-score:-1.29E+01 | ||
Methylation in Case |
7.82E-01 (Median) | Methylation in Control | 9.73E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon7 |
Methylation of SLC22A2 in hepatocellular carcinoma | [ 12 ] | |||
Location |
Body (cg08793936) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.26E+00 | Statistic Test | p-value:1.84E-10; Z-score:-3.25E+00 | ||
Methylation in Case |
5.62E-01 (Median) | Methylation in Control | 7.09E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon8 |
Methylation of SLC22A2 in hepatocellular carcinoma | [ 12 ] | |||
Location |
Body (cg04310488) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.46E+00 | Statistic Test | p-value:1.36E-06; Z-score:-1.32E+00 | ||
Methylation in Case |
2.63E-01 (Median) | Methylation in Control | 3.84E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon9 |
Methylation of SLC22A2 in hepatocellular carcinoma | [ 12 ] | |||
Location |
Body (cg14918008) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:3.70E-03; Z-score:-7.65E-01 | ||
Methylation in Case |
8.01E-01 (Median) | Methylation in Control | 8.19E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon10 |
Methylation of SLC22A2 in hepatocellular carcinoma | [ 12 ] | |||
Location |
Body (cg17098387) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:4.77E-03; Z-score:4.43E-01 | ||
Methylation in Case |
7.81E-01 (Median) | Methylation in Control | 7.33E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon11 |
Methylation of SLC22A2 in hepatocellular carcinoma | [ 12 ] | |||
Location |
Body (cg07601258) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.45E-02; Z-score:-3.44E-01 | ||
Methylation in Case |
8.71E-01 (Median) | Methylation in Control | 8.80E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon12 |
Methylation of SLC22A2 in hepatocellular carcinoma | [ 12 ] | |||
Location |
3'UTR (cg04092332) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:5.29E-11; Z-score:-4.69E+00 | ||
Methylation in Case |
7.42E-01 (Median) | Methylation in Control | 8.63E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Prostate cancer |
20 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC22A2 in prostate cancer | [ 6 ] | |||
Location |
5'UTR (cg13323097) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.51E+00 | Statistic Test | p-value:1.89E-04; Z-score:5.73E+00 | ||
Methylation in Case |
2.20E-01 (Median) | Methylation in Control | 1.46E-01 (Median) | ||
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC22A2 in prostate cancer | [ 6 ] | |||
Location |
5'UTR (cg26248082) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.19E+00 | Statistic Test | p-value:3.00E-02; Z-score:2.67E+00 | ||
Methylation in Case |
7.67E-01 (Median) | Methylation in Control | 6.44E-01 (Median) | ||
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC22A2 in prostate cancer | [ 6 ] | |||
Location |
TSS1500 (cg01352551) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:3.97E-03; Z-score:2.49E+00 | ||
Methylation in Case |
8.12E-01 (Median) | Methylation in Control | 7.34E-01 (Median) | ||
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC22A2 in prostate cancer | [ 6 ] | |||
Location |
TSS1500 (cg17174275) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:9.95E-03; Z-score:2.19E+00 | ||
Methylation in Case |
8.67E-01 (Median) | Methylation in Control | 7.96E-01 (Median) | ||
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC22A2 in prostate cancer | [ 6 ] | |||
Location |
TSS1500 (cg27043188) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.45E+00 | Statistic Test | p-value:1.29E-02; Z-score:-2.00E+00 | ||
Methylation in Case |
3.22E-01 (Median) | Methylation in Control | 4.66E-01 (Median) | ||
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon6 |
Methylation of SLC22A2 in prostate cancer | [ 6 ] | |||
Location |
TSS1500 (cg10528482) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.21E+00 | Statistic Test | p-value:1.51E-02; Z-score:1.57E+01 | ||
Methylation in Case |
8.28E-01 (Median) | Methylation in Control | 6.86E-01 (Median) | ||
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon7 |
Methylation of SLC22A2 in prostate cancer | [ 6 ] | |||
Location |
TSS1500 (cg04833514) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.17E+00 | Statistic Test | p-value:1.91E-02; Z-score:3.12E+00 | ||
Methylation in Case |
8.25E-01 (Median) | Methylation in Control | 7.03E-01 (Median) | ||
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon8 |
Methylation of SLC22A2 in prostate cancer | [ 6 ] | |||
Location |
TSS1500 (cg02707152) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.44E+00 | Statistic Test | p-value:3.01E-02; Z-score:3.38E+00 | ||
Methylation in Case |
3.34E-01 (Median) | Methylation in Control | 2.31E-01 (Median) | ||
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon9 |
Methylation of SLC22A2 in prostate cancer | [ 6 ] | |||
Location |
TSS200 (cg18335740) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.62E+00 | Statistic Test | p-value:3.86E-03; Z-score:3.84E+00 | ||
Methylation in Case |
2.91E-01 (Median) | Methylation in Control | 1.80E-01 (Median) | ||
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon10 |
Methylation of SLC22A2 in prostate cancer | [ 6 ] | |||
Location |
1stExon (cg08457872) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:3.39E-02; Z-score:1.73E+00 | ||
Methylation in Case |
9.01E-01 (Median) | Methylation in Control | 8.56E-01 (Median) | ||
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon11 |
Methylation of SLC22A2 in prostate cancer | [ 6 ] | |||
Location |
Body (cg06635952) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:3.11E+00 | Statistic Test | p-value:4.23E-03; Z-score:1.29E+01 | ||
Methylation in Case |
6.50E-01 (Median) | Methylation in Control | 2.09E-01 (Median) | ||
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon12 |
Methylation of SLC22A2 in prostate cancer | [ 6 ] | |||
Location |
Body (cg06145736) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.21E+00 | Statistic Test | p-value:6.78E-03; Z-score:2.70E+00 | ||
Methylation in Case |
8.80E-01 (Median) | Methylation in Control | 7.29E-01 (Median) | ||
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon13 |
Methylation of SLC22A2 in prostate cancer | [ 6 ] | |||
Location |
Body (cg25575590) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.39E+00 | Statistic Test | p-value:8.54E-03; Z-score:-1.19E+01 | ||
Methylation in Case |
6.48E-01 (Median) | Methylation in Control | 9.02E-01 (Median) | ||
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon14 |
Methylation of SLC22A2 in prostate cancer | [ 6 ] | |||
Location |
Body (cg15930240) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.33E+00 | Statistic Test | p-value:1.08E-02; Z-score:1.96E+00 | ||
Methylation in Case |
7.95E-01 (Median) | Methylation in Control | 5.98E-01 (Median) | ||
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon15 |
Methylation of SLC22A2 in prostate cancer | [ 6 ] | |||
Location |
Body (cg00551954) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:1.29E-02; Z-score:2.04E+00 | ||
Methylation in Case |
9.33E-01 (Median) | Methylation in Control | 8.85E-01 (Median) | ||
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon16 |
Methylation of SLC22A2 in prostate cancer | [ 6 ] | |||
Location |
Body (cg10665321) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.45E+00 | Statistic Test | p-value:2.95E-02; Z-score:2.02E+00 | ||
Methylation in Case |
6.35E-01 (Median) | Methylation in Control | 4.38E-01 (Median) | ||
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon17 |
Methylation of SLC22A2 in prostate cancer | [ 6 ] | |||
Location |
Body (cg22931795) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.51E+00 | Statistic Test | p-value:4.02E-02; Z-score:-2.37E+00 | ||
Methylation in Case |
4.12E-01 (Median) | Methylation in Control | 6.20E-01 (Median) | ||
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon18 |
Methylation of SLC22A2 in prostate cancer | [ 6 ] | |||
Location |
Body (cg04954559) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.79E+00 | Statistic Test | p-value:4.95E-02; Z-score:4.75E+00 | ||
Methylation in Case |
1.41E-01 (Median) | Methylation in Control | 7.88E-02 (Median) | ||
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon19 |
Methylation of SLC22A2 in prostate cancer | [ 6 ] | |||
Location |
3'UTR (cg09888840) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:8.80E-03; Z-score:3.47E+00 | ||
Methylation in Case |
9.35E-01 (Median) | Methylation in Control | 8.81E-01 (Median) | ||
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Bladder cancer |
14 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC22A2 in bladder cancer | [ 7 ] | |||
Location |
TSS1500 (cg07026448) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.37E+00 | Statistic Test | p-value:6.51E-06; Z-score:1.21E+01 | ||
Methylation in Case |
6.18E-01 (Median) | Methylation in Control | 4.49E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC22A2 in bladder cancer | [ 7 ] | |||
Location |
TSS1500 (cg23995605) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:2.05E-04; Z-score:-3.50E+00 | ||
Methylation in Case |
8.82E-01 (Median) | Methylation in Control | 9.24E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC22A2 in bladder cancer | [ 7 ] | |||
Location |
TSS200 (cg19627213) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.57E+00 | Statistic Test | p-value:3.81E-05; Z-score:-4.72E+00 | ||
Methylation in Case |
3.93E-01 (Median) | Methylation in Control | 6.18E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC22A2 in bladder cancer | [ 7 ] | |||
Location |
TSS200 (cg06236276) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:5.91E-03; Z-score:-1.99E+00 | ||
Methylation in Case |
5.95E-01 (Median) | Methylation in Control | 6.61E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC22A2 in bladder cancer | [ 7 ] | |||
Location |
TSS200 (cg04294894) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:1.30E-02; Z-score:-2.26E+00 | ||
Methylation in Case |
7.62E-01 (Median) | Methylation in Control | 8.06E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon6 |
Methylation of SLC22A2 in bladder cancer | [ 7 ] | |||
Location |
TSS200 (cg26939503) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.17E+00 | Statistic Test | p-value:1.32E-02; Z-score:-4.78E+00 | ||
Methylation in Case |
5.51E-01 (Median) | Methylation in Control | 6.43E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon7 |
Methylation of SLC22A2 in bladder cancer | [ 7 ] | |||
Location |
TSS200 (cg02666489) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:1.97E-02; Z-score:-1.90E+00 | ||
Methylation in Case |
6.54E-01 (Median) | Methylation in Control | 7.06E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon8 |
Methylation of SLC22A2 in bladder cancer | [ 7 ] | |||
Location |
1stExon (cg27204616) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:2.44E-03; Z-score:-4.31E+00 | ||
Methylation in Case |
9.01E-01 (Median) | Methylation in Control | 9.52E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon9 |
Methylation of SLC22A2 in bladder cancer | [ 7 ] | |||
Location |
1stExon (cg19561774) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:2.75E-03; Z-score:-1.71E+00 | ||
Methylation in Case |
8.25E-01 (Median) | Methylation in Control | 8.48E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon10 |
Methylation of SLC22A2 in bladder cancer | [ 7 ] | |||
Location |
1stExon (cg13717233) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.21E-02; Z-score:-1.31E+00 | ||
Methylation in Case |
8.24E-01 (Median) | Methylation in Control | 8.45E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon11 |
Methylation of SLC22A2 in bladder cancer | [ 7 ] | |||
Location |
Body (cg14918008) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.32E+00 | Statistic Test | p-value:8.47E-10; Z-score:8.08E+00 | ||
Methylation in Case |
7.69E-01 (Median) | Methylation in Control | 5.84E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon12 |
Methylation of SLC22A2 in bladder cancer | [ 7 ] | |||
Location |
Body (cg04310488) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.66E+00 | Statistic Test | p-value:1.06E-05; Z-score:-3.87E+00 | ||
Methylation in Case |
3.84E-01 (Median) | Methylation in Control | 6.40E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon13 |
Methylation of SLC22A2 in bladder cancer | [ 7 ] | |||
Location |
Body (cg02490934) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.48E+00 | Statistic Test | p-value:1.13E-05; Z-score:-4.29E+00 | ||
Methylation in Case |
4.75E-01 (Median) | Methylation in Control | 7.03E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon14 |
Methylation of SLC22A2 in bladder cancer | [ 7 ] | |||
Location |
Body (cg07601258) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:3.33E-03; Z-score:-3.43E+00 | ||
Methylation in Case |
8.79E-01 (Median) | Methylation in Control | 9.12E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Breast cancer |
19 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC22A2 in breast cancer | [ 8 ] | |||
Location |
TSS1500 (cg14450766) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.50E+00 | Statistic Test | p-value:3.71E-15; Z-score:-1.93E+00 | ||
Methylation in Case |
2.08E-01 (Median) | Methylation in Control | 3.11E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC22A2 in breast cancer | [ 8 ] | |||
Location |
TSS1500 (cg23995605) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:3.50E-14; Z-score:-5.03E+00 | ||
Methylation in Case |
7.86E-01 (Median) | Methylation in Control | 8.87E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC22A2 in breast cancer | [ 8 ] | |||
Location |
TSS1500 (cg19499998) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:5.42E-13; Z-score:-3.65E+00 | ||
Methylation in Case |
8.06E-01 (Median) | Methylation in Control | 8.96E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC22A2 in breast cancer | [ 8 ] | |||
Location |
TSS1500 (cg25545503) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:1.14E-09; Z-score:-1.80E+00 | ||
Methylation in Case |
8.54E-01 (Median) | Methylation in Control | 9.32E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC22A2 in breast cancer | [ 8 ] | |||
Location |
TSS200 (cg26939503) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.54E+00 | Statistic Test | p-value:3.15E-20; Z-score:-4.08E+00 | ||
Methylation in Case |
4.32E-01 (Median) | Methylation in Control | 6.67E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon6 |
Methylation of SLC22A2 in breast cancer | [ 8 ] | |||
Location |
TSS200 (cg06236276) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.32E+00 | Statistic Test | p-value:1.62E-19; Z-score:-4.20E+00 | ||
Methylation in Case |
5.03E-01 (Median) | Methylation in Control | 6.66E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon7 |
Methylation of SLC22A2 in breast cancer | [ 8 ] | |||
Location |
TSS200 (cg04294894) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.40E+00 | Statistic Test | p-value:1.45E-16; Z-score:-3.33E+00 | ||
Methylation in Case |
5.62E-01 (Median) | Methylation in Control | 7.89E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon8 |
Methylation of SLC22A2 in breast cancer | [ 8 ] | |||
Location |
TSS200 (cg19627213) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.51E+00 | Statistic Test | p-value:8.30E-14; Z-score:-1.97E+00 | ||
Methylation in Case |
3.98E-01 (Median) | Methylation in Control | 6.01E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon9 |
Methylation of SLC22A2 in breast cancer | [ 8 ] | |||
Location |
TSS200 (cg21755969) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:1.07E-08; Z-score:-2.33E+00 | ||
Methylation in Case |
4.74E-01 (Median) | Methylation in Control | 5.52E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon10 |
Methylation of SLC22A2 in breast cancer | [ 8 ] | |||
Location |
TSS200 (cg02666489) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:5.03E-08; Z-score:-1.06E+00 | ||
Methylation in Case |
6.99E-01 (Median) | Methylation in Control | 7.47E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon11 |
Methylation of SLC22A2 in breast cancer | [ 8 ] | |||
Location |
1stExon (cg13717233) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:5.12E-13; Z-score:-4.25E+00 | ||
Methylation in Case |
7.54E-01 (Median) | Methylation in Control | 8.36E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon12 |
Methylation of SLC22A2 in breast cancer | [ 8 ] | |||
Location |
1stExon (cg27204616) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:2.39E-12; Z-score:-6.29E+00 | ||
Methylation in Case |
8.15E-01 (Median) | Methylation in Control | 9.36E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon13 |
Methylation of SLC22A2 in breast cancer | [ 8 ] | |||
Location |
1stExon (cg19561774) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:1.15E-09; Z-score:-1.89E+00 | ||
Methylation in Case |
7.54E-01 (Median) | Methylation in Control | 8.18E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon14 |
Methylation of SLC22A2 in breast cancer | [ 8 ] | |||
Location |
Body (cg17098387) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.30E+00 | Statistic Test | p-value:6.95E-20; Z-score:-3.61E+00 | ||
Methylation in Case |
5.59E-01 (Median) | Methylation in Control | 7.27E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon15 |
Methylation of SLC22A2 in breast cancer | [ 8 ] | |||
Location |
Body (cg04310488) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.34E+00 | Statistic Test | p-value:5.15E-15; Z-score:-2.69E+00 | ||
Methylation in Case |
5.64E-01 (Median) | Methylation in Control | 7.58E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon16 |
Methylation of SLC22A2 in breast cancer | [ 8 ] | |||
Location |
Body (cg14918008) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:2.00E-11; Z-score:-1.81E+00 | ||
Methylation in Case |
6.82E-01 (Median) | Methylation in Control | 7.72E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon17 |
Methylation of SLC22A2 in breast cancer | [ 8 ] | |||
Location |
Body (cg03488613) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:8.15E-10; Z-score:-2.01E+00 | ||
Methylation in Case |
8.03E-01 (Median) | Methylation in Control | 8.75E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon18 |
Methylation of SLC22A2 in breast cancer | [ 8 ] | |||
Location |
Body (cg07601258) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:2.64E-09; Z-score:-1.64E+00 | ||
Methylation in Case |
8.43E-01 (Median) | Methylation in Control | 8.85E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon19 |
Methylation of SLC22A2 in breast cancer | [ 8 ] | |||
Location |
Body (cg02490934) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.21E+00 | Statistic Test | p-value:8.82E-03; Z-score:-1.05E+00 | ||
Methylation in Case |
4.20E-01 (Median) | Methylation in Control | 5.09E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Renal cell carcinoma |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC22A2 in clear cell renal cell carcinoma | [ 9 ] | |||
Location |
TSS1500 (cg23995605) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:3.94E-04; Z-score:-2.90E-02 | ||
Methylation in Case |
9.23E-01 (Median) | Methylation in Control | 9.24E-01 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC22A2 in clear cell renal cell carcinoma | [ 9 ] | |||
Location |
TSS200 (cg04294894) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:3.59E-02; Z-score:-1.28E+00 | ||
Methylation in Case |
6.05E-01 (Median) | Methylation in Control | 6.65E-01 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC22A2 in clear cell renal cell carcinoma | [ 9 ] | |||
Location |
Body (cg02490934) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.28E+00 | Statistic Test | p-value:3.42E-03; Z-score:-2.82E+00 | ||
Methylation in Case |
4.94E-01 (Median) | Methylation in Control | 6.34E-01 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC22A2 in clear cell renal cell carcinoma | [ 9 ] | |||
Location |
Body (cg07601258) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:6.36E-03; Z-score:-9.85E-01 | ||
Methylation in Case |
7.68E-01 (Median) | Methylation in Control | 8.14E-01 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Colon cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC22A2 in colon adenocarcinoma | [ 10 ] | |||
Location |
TSS1500 (cg09595245) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:5.57E-04; Z-score:-2.37E+00 | ||
Methylation in Case |
6.72E-01 (Median) | Methylation in Control | 7.80E-01 (Median) | ||
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC22A2 in colon adenocarcinoma | [ 10 ] | |||
Location |
Body (cg05672174) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:9.28E-05; Z-score:-2.18E+00 | ||
Methylation in Case |
6.99E-01 (Median) | Methylation in Control | 7.60E-01 (Median) | ||
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC22A2 in colon adenocarcinoma | [ 10 ] | |||
Location |
Body (cg26907313) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:1.00E-03; Z-score:-3.03E+00 | ||
Methylation in Case |
7.19E-01 (Median) | Methylation in Control | 8.25E-01 (Median) | ||
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Depression |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC22A2 in depression | [ 11 ] | |||
Location |
TSS1500 (cg07026448) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:4.21E-02; Z-score:1.81E-01 | ||
Methylation in Case |
4.21E-01 (Median) | Methylation in Control | 4.14E-01 (Median) | ||
Studied Phenotype |
Depression[ ICD-11:6A8Z] | ||||
Experimental Material |
Patient tissue samples | ||||
HIV infection |
8 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC22A2 in HIV infection | [ 13 ] | |||
Location |
TSS1500 (cg14450766) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:6.14E-04; Z-score:-3.43E-01 | ||
Methylation in Case |
2.51E-01 (Median) | Methylation in Control | 2.69E-01 (Median) | ||
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC22A2 in HIV infection | [ 13 ] | |||
Location |
TSS1500 (cg19499998) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:7.98E-04; Z-score:7.92E-01 | ||
Methylation in Case |
9.33E-01 (Median) | Methylation in Control | 9.20E-01 (Median) | ||
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC22A2 in HIV infection | [ 13 ] | |||
Location |
TSS200 (cg19627213) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:4.26E-06; Z-score:-1.45E+00 | ||
Methylation in Case |
5.04E-01 (Median) | Methylation in Control | 5.80E-01 (Median) | ||
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC22A2 in HIV infection | [ 13 ] | |||
Location |
TSS200 (cg04294894) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:3.10E-03; Z-score:-6.46E-01 | ||
Methylation in Case |
8.24E-01 (Median) | Methylation in Control | 8.48E-01 (Median) | ||
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC22A2 in HIV infection | [ 13 ] | |||
Location |
TSS200 (cg06236276) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:3.82E-02; Z-score:-4.79E-01 | ||
Methylation in Case |
6.56E-01 (Median) | Methylation in Control | 6.77E-01 (Median) | ||
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon6 |
Methylation of SLC22A2 in HIV infection | [ 13 ] | |||
Location |
1stExon (cg19561774) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:2.37E-06; Z-score:1.25E+00 | ||
Methylation in Case |
8.94E-01 (Median) | Methylation in Control | 8.69E-01 (Median) | ||
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon7 |
Methylation of SLC22A2 in HIV infection | [ 13 ] | |||
Location |
Body (cg17098387) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:2.08E-04; Z-score:-1.02E+00 | ||
Methylation in Case |
6.62E-01 (Median) | Methylation in Control | 7.17E-01 (Median) | ||
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon8 |
Methylation of SLC22A2 in HIV infection | [ 13 ] | |||
Location |
Body (cg02490934) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:2.97E-04; Z-score:-1.08E+00 | ||
Methylation in Case |
7.76E-01 (Median) | Methylation in Control | 8.34E-01 (Median) | ||
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Lung adenocarcinoma |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC22A2 in lung adenocarcinoma | [ 14 ] | |||
Location |
TSS1500 (cg07026448) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:3.92E-02; Z-score:7.17E-01 | ||
Methylation in Case |
6.11E-01 (Median) | Methylation in Control | 5.78E-01 (Median) | ||
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC22A2 in lung adenocarcinoma | [ 14 ] | |||
Location |
TSS200 (cg19627213) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:3.43E-02; Z-score:-3.14E+00 | ||
Methylation in Case |
5.50E-01 (Median) | Methylation in Control | 6.17E-01 (Median) | ||
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC22A2 in lung adenocarcinoma | [ 14 ] | |||
Location |
Body (cg17098387) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:2.72E-02; Z-score:-3.43E+00 | ||
Methylation in Case |
6.86E-01 (Median) | Methylation in Control | 7.62E-01 (Median) | ||
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Papillary thyroid cancer |
13 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC22A2 in papillary thyroid cancer | [ 15 ] | |||
Location |
TSS1500 (cg25545503) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:6.84E-11; Z-score:1.47E+00 | ||
Methylation in Case |
8.75E-01 (Median) | Methylation in Control | 8.23E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC22A2 in papillary thyroid cancer | [ 15 ] | |||
Location |
TSS1500 (cg19499998) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:1.17E-10; Z-score:1.56E+00 | ||
Methylation in Case |
8.57E-01 (Median) | Methylation in Control | 8.01E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC22A2 in papillary thyroid cancer | [ 15 ] | |||
Location |
TSS1500 (cg23995605) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.64E-09; Z-score:-2.12E+00 | ||
Methylation in Case |
9.27E-01 (Median) | Methylation in Control | 9.53E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC22A2 in papillary thyroid cancer | [ 15 ] | |||
Location |
TSS1500 (cg07026448) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:9.62E-03; Z-score:1.09E+00 | ||
Methylation in Case |
6.88E-01 (Median) | Methylation in Control | 6.37E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC22A2 in papillary thyroid cancer | [ 15 ] | |||
Location |
TSS200 (cg06236276) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:1.58E-06; Z-score:-1.16E+00 | ||
Methylation in Case |
6.87E-01 (Median) | Methylation in Control | 7.30E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon6 |
Methylation of SLC22A2 in papillary thyroid cancer | [ 15 ] | |||
Location |
TSS200 (cg26939503) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:2.36E-05; Z-score:-6.23E-01 | ||
Methylation in Case |
6.43E-01 (Median) | Methylation in Control | 6.72E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon7 |
Methylation of SLC22A2 in papillary thyroid cancer | [ 15 ] | |||
Location |
TSS200 (cg02666489) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.10E+00 | Statistic Test | p-value:5.04E-05; Z-score:1.73E+00 | ||
Methylation in Case |
8.37E-01 (Median) | Methylation in Control | 7.62E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon8 |
Methylation of SLC22A2 in papillary thyroid cancer | [ 15 ] | |||
Location |
TSS200 (cg19627213) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:3.42E-03; Z-score:-5.49E-01 | ||
Methylation in Case |
6.66E-01 (Median) | Methylation in Control | 7.03E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon9 |
Methylation of SLC22A2 in papillary thyroid cancer | [ 15 ] | |||
Location |
1stExon (cg19561774) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:5.02E-09; Z-score:-1.47E+00 | ||
Methylation in Case |
9.20E-01 (Median) | Methylation in Control | 9.37E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon10 |
Methylation of SLC22A2 in papillary thyroid cancer | [ 15 ] | |||
Location |
1stExon (cg27204616) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.60E-06; Z-score:-1.22E+00 | ||
Methylation in Case |
9.01E-01 (Median) | Methylation in Control | 9.18E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon11 |
Methylation of SLC22A2 in papillary thyroid cancer | [ 15 ] | |||
Location |
1stExon (cg13717233) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:3.30E-06; Z-score:-9.37E-01 | ||
Methylation in Case |
8.97E-01 (Median) | Methylation in Control | 9.11E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon12 |
Methylation of SLC22A2 in papillary thyroid cancer | [ 15 ] | |||
Location |
Body (cg02490934) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:7.43E-06; Z-score:-1.20E+00 | ||
Methylation in Case |
7.82E-01 (Median) | Methylation in Control | 8.36E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon13 |
Methylation of SLC22A2 in papillary thyroid cancer | [ 15 ] | |||
Location |
Body (cg07601258) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:8.06E-04; Z-score:-2.45E-01 | ||
Methylation in Case |
9.40E-01 (Median) | Methylation in Control | 9.43E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Systemic lupus erythematosus |
7 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC22A2 in systemic lupus erythematosus | [ 16 ] | |||
Location |
TSS1500 (cg23995605) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:2.95E-02; Z-score:-2.21E-01 | ||
Methylation in Case |
9.19E-01 (Median) | Methylation in Control | 9.24E-01 (Median) | ||
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC22A2 in systemic lupus erythematosus | [ 16 ] | |||
Location |
TSS200 (cg26939503) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.19E-03; Z-score:-2.66E-01 | ||
Methylation in Case |
6.52E-01 (Median) | Methylation in Control | 6.72E-01 (Median) | ||
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC22A2 in systemic lupus erythematosus | [ 16 ] | |||
Location |
TSS200 (cg02666489) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.35E-02; Z-score:-2.51E-01 | ||
Methylation in Case |
8.70E-01 (Median) | Methylation in Control | 8.77E-01 (Median) | ||
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC22A2 in systemic lupus erythematosus | [ 16 ] | |||
Location |
TSS200 (cg06236276) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:3.12E-02; Z-score:-1.25E-01 | ||
Methylation in Case |
7.03E-01 (Median) | Methylation in Control | 7.11E-01 (Median) | ||
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC22A2 in systemic lupus erythematosus | [ 16 ] | |||
Location |
Body (cg07601258) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:5.79E-03; Z-score:-2.06E-01 | ||
Methylation in Case |
9.24E-01 (Median) | Methylation in Control | 9.28E-01 (Median) | ||
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon6 |
Methylation of SLC22A2 in systemic lupus erythematosus | [ 16 ] | |||
Location |
Body (cg17098387) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:7.48E-03; Z-score:-1.85E-01 | ||
Methylation in Case |
6.55E-01 (Median) | Methylation in Control | 6.69E-01 (Median) | ||
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon7 |
Methylation of SLC22A2 in systemic lupus erythematosus | [ 16 ] | |||
Location |
Body (cg02490934) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:3.70E-02; Z-score:-1.77E-01 | ||
Methylation in Case |
7.69E-01 (Median) | Methylation in Control | 7.85E-01 (Median) | ||
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Panic disorder |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC22A2 in panic disorder | [ 17 ] | |||
Location |
TSS200 (cg04294894) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:3.35E-02; Z-score:4.99E-01 | ||
Methylation in Case |
2.72E+00 (Median) | Methylation in Control | 2.53E+00 (Median) | ||
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC22A2 in panic disorder | [ 17 ] | |||
Location |
TSS200 (cg21755969) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.30E+00 | Statistic Test | p-value:3.64E-02; Z-score:4.24E-01 | ||
Methylation in Case |
6.92E-01 (Median) | Methylation in Control | 5.31E-01 (Median) | ||
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
Experimental Material |
Patient tissue samples | ||||
Atypical teratoid rhabdoid tumor |
7 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC22A2 in atypical teratoid rhabdoid tumor | [ 18 ] | |||
Location |
1stExon (cg13717233) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.49E+00 | Statistic Test | p-value:2.58E-19; Z-score:-3.07E+00 | ||
Methylation in Case |
5.11E-01 (Median) | Methylation in Control | 7.62E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC22A2 in atypical teratoid rhabdoid tumor | [ 18 ] | |||
Location |
1stExon (cg19561774) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.18E+00 | Statistic Test | p-value:1.13E-17; Z-score:-2.79E+00 | ||
Methylation in Case |
7.34E-01 (Median) | Methylation in Control | 8.65E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC22A2 in atypical teratoid rhabdoid tumor | [ 18 ] | |||
Location |
1stExon (cg27204616) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.36E+00 | Statistic Test | p-value:9.27E-16; Z-score:-3.43E+00 | ||
Methylation in Case |
5.38E-01 (Median) | Methylation in Control | 7.33E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC22A2 in atypical teratoid rhabdoid tumor | [ 18 ] | |||
Location |
Body (cg02490934) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.67E-04; Z-score:-7.24E-01 | ||
Methylation in Case |
8.91E-01 (Median) | Methylation in Control | 9.16E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC22A2 in atypical teratoid rhabdoid tumor | [ 18 ] | |||
Location |
Body (cg03488613) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.33E+00 | Statistic Test | p-value:3.52E-04; Z-score:-1.02E+00 | ||
Methylation in Case |
5.67E-01 (Median) | Methylation in Control | 7.52E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon6 |
Methylation of SLC22A2 in atypical teratoid rhabdoid tumor | [ 18 ] | |||
Location |
Body (cg04310488) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:7.00E-04; Z-score:-4.47E-01 | ||
Methylation in Case |
7.84E-01 (Median) | Methylation in Control | 8.16E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon7 |
Methylation of SLC22A2 in atypical teratoid rhabdoid tumor | [ 18 ] | |||
Location |
Body (cg07601258) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:4.49E-03; Z-score:6.32E-01 | ||
Methylation in Case |
9.30E-01 (Median) | Methylation in Control | 8.75E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Colorectal cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC22A2 in colorectal cancer | [ 19 ] | |||
Location |
1stExon (cg19561774) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:8.06E-03; Z-score:-1.88E-01 | ||
Methylation in Case |
9.48E-01 (Median) | Methylation in Control | 9.50E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC22A2 in colorectal cancer | [ 19 ] | |||
Location |
Body (cg03488613) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:9.96E-03; Z-score:9.12E-01 | ||
Methylation in Case |
9.20E-01 (Median) | Methylation in Control | 8.94E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC22A2 in colorectal cancer | [ 19 ] | |||
Location |
Body (cg07601258) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:2.47E-02; Z-score:3.07E-01 | ||
Methylation in Case |
9.45E-01 (Median) | Methylation in Control | 9.40E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Pancretic ductal adenocarcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC22A2 in pancretic ductal adenocarcinoma | [ 20 ] | |||
Location |
Body (cg12933431) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.26E+00 | Statistic Test | p-value:1.75E-03; Z-score:1.32E+00 | ||
Methylation in Case |
6.71E-01 (Median) | Methylation in Control | 5.32E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Esthesioneuroblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Moderate hypomethylation of SLC22A2 in esthesioneuroblastoma than that in healthy individual | ||||
Studied Phenotype |
Esthesioneuroblastoma [ICD-11:2D50.1] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:1.63E-05; Fold-change:-0.213965366; Z-score:-1.711614709 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Medulloblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Moderate hypomethylation of SLC22A2 in medulloblastoma than that in healthy individual | ||||
Studied Phenotype |
Medulloblastoma [ICD-11:2A00.10] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:6.98E-86; Fold-change:-0.263759902; Z-score:-3.445624036 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Melanoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Moderate hypomethylation of SLC22A2 in melanoma than that in healthy individual | ||||
Studied Phenotype |
Melanoma [ICD-11:2C30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.002420386; Fold-change:-0.241840851; Z-score:-1.569377238 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Multilayered rosettes embryonal tumour |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Moderate hypomethylation of SLC22A2 in multilayered rosettes embryonal tumour than that in healthy individual | ||||
Studied Phenotype |
Multilayered rosettes embryonal tumour [ICD-11:2A00.1] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:1.37E-09; Fold-change:-0.261324171; Z-score:-2.25939206 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Cerebellar liponeurocytoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC22A2 in cerebellar liponeurocytoma than that in healthy individual | ||||
Studied Phenotype |
Cerebellar liponeurocytoma [ICD-11:2A00.0Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:1.59E-08; Fold-change:-0.617671121; Z-score:-2.933433032 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Lymphoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC22A2 in lymphoma than that in healthy individual | ||||
Studied Phenotype |
Lymphoma [ICD-11:2B30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:1.35E-08; Fold-change:-0.308339461; Z-score:-2.124187076 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Meningioma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC22A2 in meningioma than that in healthy individual | ||||
Studied Phenotype |
Meningioma [ICD-11:2A01.0Z] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:1.25E-62; Fold-change:-0.340860889; Z-score:-3.217549796 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Posterior fossa ependymoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC22A2 in posterior fossa ependymoma than that in healthy individual | ||||
Studied Phenotype |
Posterior fossa ependymoma [ICD-11:2D50.2] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:3.20E-102; Fold-change:-0.383390542; Z-score:-3.474081509 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Histone acetylation |
|||||
Renal cell carcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Hypoacetylation of SLC22A2 in renal cell carcinoma | [ 21 ] | |||
Location |
Promoter | ||||
Epigenetic Type |
Histone acetylation | Experiment Method | Chromatin immunoprecipitation | ||
Related Molecular Changes | Down regulation ofSLC22A2 | Experiment Method | RT-qPCR | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patients samples of human; Multiple cell lines of human | ||||
Additional Notes |
Combined treatment using the DNA methylation inhibitor decitabine and the histone deacetylase inhibitor vorinostat significantly increased the expression of OCT2 in RCC cell lines, which sensitized these cells to oxaliplatin. | ||||
Epigenetic Phenomenon2 |
Hypoacetylation of SLC22A2 in renal cell carcinoma | [ 21 ] | |||
Location |
Promoter | ||||
Epigenetic Type |
Histone acetylation | Experiment Method | Chromatin immunoprecipitation | ||
Related Molecular Changes | Down regulation ofSLC22A2 | Experiment Method | RT-qPCR | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patients samples of human; Multiple cell lines of human | ||||
Additional Notes |
Combined treatment using the DNA methylation inhibitor decitabine and the histone deacetylase inhibitor vorinostat significantly increased the expression of OCT2 in RCC cell lines, which sensitized these cells to oxaliplatin. | ||||
microRNA |
|||||
Renal cell carcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
miR-21 silencing increased SLC22A2 expression | [ 22 ] | |||
Epigenetic Type |
microRNA | Experiment Method | . | ||
Related Molecular Changes | Down regulation ofSLC22A2 | Experiment Method | RT-qPCR | ||
miRNA Stemloop ID |
miR-21 | miRNA Mature ID | miR-21-5p | ||
miRNA Sequence |
UAGCUUAUCAGACUGAUGUUGA | ||||
miRNA Target Type |
Unknown | ||||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Multiple cell lines of human | ||||
Additional Notes |
Targeting miR-21 decreases expression of SLC22A2 and promotes chemosensitivity of renal carcinoma. | ||||
Unclear Phenotype |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
miR-335 directly targets SLC22A2 | [ 23 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-335 | miRNA Mature ID | miR-335-5p | ||
miRNA Sequence |
UCAAGAGCAAUAACGAAAAAUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.